Сифак болезнь: симптомы, причины, диагностика, лечение и профилактика

Содержание

симптомы, причины, диагностика, лечение и профилактика

В группе венерических заболеваний сифилис занимает лидирующие позиции. Во всем мире ежегодно им заражается до 6 млн. людей. Отрицательная статистика свидетельствует о распространенности инфекции и низком уровне защиты в интимной жизни. За последние 20 лет в Европе количество пациентов с этим диагнозом увеличилось. Согласно сведениям Минздрава, в России динамика обратная – количество случаев заболеваемости снизилось в 10 раз. На 100 000 человек приходится только 16,5 зараженных. Сифилис лечится – это единственный плюс, о котором можно с уверенностью сказать, когда речь идет о венерической инфекции.

Симптомы и признаки сифилиса

Инкубационный период составляет от 3 до 6 недель.

Проявиться может на любой стадии. Выделяют три основных: первичную, вторичную и третичную (позднюю). Проявлять сифилис симптомы начинает в месте контакта. У каждой стадии есть набор признаков, но в целом это заболевание называют большим имитатором. Оно может маскироваться под разные патологии. В зависимости от стадии сифилиса длительность лечения разная.

Первичная стадия

Первые высыпания появляются приблизительно на 3-4 неделю. Начинается с безболезненной язвы (твердый шанкр) на первичной стадии. Локализация – слизистые оболочки, половые органы, около ануса, в прямой кишке и др. Спустя несколько недель язва заживет, а сифилис переходит в следующую форму.

Вторичная стадия

На теле, слизистых оболочках, ладонях и стопах появляются буровато-красные пятна. Эти признаки сифилиса сложно не заметить. Характерно, что боли или зуда нет. Присоединиться к симптомам может температура, головная и мышечная боль. Если у пациента вторичный сифилис, могут увеличиться лимфатические узлы. Усугубляется состояние зараженного человека и следующими симптомами:

  • специфическая ангина;
  • охриплость голоса;
  • поражение глаз и снижение зрения.

Третичная стадия

Первый и второй периоды сифилиса симптомы проявляют не сильно выражено. Если инфекция не лечилась в течение 3-4 лет, она переходит в латентное состояние. Для третичной стадии характерны серьезные проблемы со здоровьем. Происходит необратимое поражение внутренних органов и важных систем организма. На коже формируются инфекционные бугорки и гуммы, которые периодически могут изъявляться, оставляя рубцы. Такие стадии сифилиса развиваются с параллельным поражением мозга, сердечно-сосудистой системы, костей, печени, глаз. Здоровье может ухудшиться вплоть до паралича, нарушения координации движений, полной потери зрения и слабоумия.

У вас появились симптомы сифилиса?

Точно диагностировать заболевание может только врач. Не откладывайте консультацию — позвоните по телефону +7 (495) 775-73-60

Причины возникновения

Спирохета Treponema pallidum – возбудитель сифилиса, который переносится из организма в организм при контакте с выделениями и слизистыми оболочками больного человека. За пределами тканей носителя трепонема имеет короткий период жизнедеятельности. По этой причине она мигрирует при непосредственном контакте.

Пути заражения

Как передается сифилис или другие виды венерических заболеваний – это надо знать для собственной безопасности и сохранения здоровья. В основном заражаются половым путем. Частая смена партнеров также повышает риски подхватить инфекцию. Сифилис пути заражения имеет не только в виде незащищенных половых актов. Бытовым способом тоже можно заразиться болезнью, хотя это происходит редко. Сифилитические высыпания на теле и слизистых остаются особо заразными в первые 2 года от начала инкубационного периода. Если больные сифилисом женщины планируют беременность или она уже есть, передача инфекции ребенку может произойти внутриутробно.

Факторы риска

Факторами риска являются социальные и экономические изменения. Это проявляется в снижении уровня жизни относительно не только беспорядочных половых связей, но и употребления наркотиков. Среди инъекционных наркоманов уровень заболеваемости составляет до 58%. Но есть и другая сторона вопроса, когда не идет речь о неблагополучности в определенных слоях населения. Риск стать носителем есть при передаче возбудителя через кровь. В группе риска всегда находятся люди с патологиями иммунной системы.

Осложнения и последствия сифилиса

Проявляется сифилис или не проявляется, но негативное влияние на внутренние органы оказывает в любом случае. Закономерно, что несвоевременное лечение приводит к тяжелым и необратимым последствиям. В списке осложнений находятся следующие:

  • поражение центральной нервной системы;
  • поражение сердечно-сосудистой системы;
  • нарушение памяти интеллектуальных способностей;
  • неврологические дефициты;
  • слепота и потеря слуха;
  • менингит.

Когда следует обратиться к врачу

При подозрении на ИППП и сифилис нужно обратиться к дерматовенерологу, который занимается вопросами диагностики и лечения этого заболевания. АО «Медицина» (клиника академика Ройтберга) расположена в центре Москвы: 2-й Тверской-Ямской пер., 10.

Поводом сходить на консультацию к доктору может стать плохое самочувствие с инфекционными или воспалительными проявлениями в области мочеполовой системы. Появление язвочек и высыпаний внутри бедер, зуд и жжение во время полового акта или мочеиспускания должны насторожить. Признаки сифилиса могут быть скрытыми, но на плановом осмотре с анализами заболевание может диагностироваться случайным образом.

Подготовка к посещению врача

Прием у дерматовенеролога имеет определенную специфику. В первую очередь нужно провести гигиенические процедуры без мыла или других косметических средств. Стеснение надо побороть до входа в кабинет. Доктор детально будет расспрашивать о подробностях интимной жизни, количестве партнеров, привычках. Это необходимо для составления общего анамнеза. Рекомендуется в течение 2-3 дней до приема не вступать в половую связь. За несколько часов до осмотра нужно воздержаться от мочеиспускания, чтоб доктор мог взять анализы на наличие возбудителей ИППП.

При наличии результатов разных видов лабораторных или инструментальных исследований за последние 6 месяцев возьмите их с собой. Особенно, если проявление сифилиса уже зафиксировано.

Диагностика сифилиса

Определить факт наличия инфекции у мужчины или женщины могут врачи разной специализации. Диагностика сифилиса проводится венерологом, гинекологом, дерматологом, урологом и др. На первом этапе диагностики доктор выполняет общий осмотр на выявление типичных признаков инфекции. Проявлять сифилис симптомы может и в стертой форме, поэтому проведение анализов и тестов помогает детализировать ситуацию для постановки правильного диагноза. Первый пункт – сдают кровь на сифилис из вены (RPR, реакция Вассермана RW). Если есть незаживленный твердый шанкр, с него делают соскоб для микроскопического исследования.

Возможно, что сифилис положительный результат покажет в анализе. Такое может быть в случае беременности, употреблении очень жирной пищи, недавно перенесенной вакцинации или другой инфекции.

Выявить сифилис у женщин может гинеколог, посещать которого рекомендуется каждые 6 месяцев. При подозрении на инфекцию назначают анализы и дополнительные исследования. Продиагностировать сифилис у мужчин помогает уролог, к которому записываются при появлении характерных симптомов в области мочеполовой системы.

Лечение заражения бледной трепонемой

В начале выбора терапии кровь на сифилис сдают для определения наличия антител. Медикаментозная терапия подбирается индивидуально в зависимости от стадии заболевания и тяжести его протекания.

Влияет на выбор препаратов и факт беременности у женщин. Преимущественно применяют бензатина бензилпенициллин замедленного высвобождения («Бициллин» L-A). Лечение сифилиса проводят и рядом других препаратов. Терапия должна быть комплексной. Пациентам дополнительно назначают общеукрепляющие препараты, иммунотерапию и физиопроцедуры.

Можно ли заразиться сифилисом во второй раз – однозначно положительный ответ на этот вопрос. Излечившиеся пациенты могут повторно стать носителями инфекции при несоблюдении правил безопасности относительно здоровья. Антибиотикотерапия является единственно эффективным методом вылечить половой сифилис на разных стадиях.

Домашние средства лечения

Народная медицина развивалась веками, а с ИППП сталкивались люди и много тысяч лет назад. В копилке знахарей есть способы бороться с бледной трепонемой, но в наше время проводить лечение сифилиса в домашних условиях – ошибочное решение. Раньше врачи рекомендовали делать целебный напиток на основе вина, яблочного сока и разведенного водой клубничного варенья. Смесь доводили до кипения, остужали и добавляли толченый чеснок. Снадобье сулило избавление от бледной трепонемы. Болезнь сифилис лечили и процеженным отваром корня лопуха или хмеля.

Современные методы терапии более эффективные относительно устранения венерической инфекции. Как только появились первые признаки сифилиса, значит, болезнь только началась. Это заблуждение. На этой стадии инфекция уже серьезно прогрессирует, требуя немедленного лечения. В противном случае она может перейти в хроническую форму.

Мифы и опасные заблуждения в лечении

Анализ на сифилис будет отрицательный после терапии – это заблуждение. Он может показывать ложноположительный результат, что связано с наличием антител в крови.

Презерватив может 100% защитить от заражения бледной трепонемой – это не совсем так, хотя заболевание и передается половым путем. Большой риск представляют мокнущие и открытые язвы на теле или слизистых оболочках. Заражение сифилисом при таком контакте неизбежно.

Если ИППП не беспокоит и не проявляет признаков, можно не переживать за свое здоровье. Это заблуждение, потому что инфекции могут протекать в скрытом виде. И только анализ на сифилис может показать истинную картину.

Профилактика заражения бледной трепонемой

Достаточно посмотреть, как выглядит сифилис, чтобы принять решение об отказе от беспорядочной половой жизни. Это действенный способ профилактики. Случайные половые контакт несут в себе большой риск.

Если обстоятельства таковы, что приходится совместно проживать с зараженным человеком, необходимо соблюдать строгие правила гигиены. Бытовой уровень передачи инфекции минимален по риску, но он есть. Посмотрите, как выглядит сифилис, и вы будете знать возможные последствия болезни. Периодически посещать врачей, чтобы была выполнена профилактика сифилиса, – это эффективный метод подтвердить или опровергнуть ИППП.

Как записаться к дерматовенерологу

В АО «Медицина» (клиника академика Ройтберга) прием проводят опытные доктора. Диагностику и лечение болезни сифилис выполняют врачи разной специальности. Запись к докторам клиники доступна и в режиме онлайн, и через справочную по телефону: +7 (495) 775-73-60. Клиника находится в центре Москвы по адресу: 2-й Тверской-Ямской переулок, дом 10.

Здоровье проверять и поддерживать вместе с профессионалами просто. Главное – своевременно обращаться за помощью.

Сифилис - КВД №2

Что такое сифилис?

Сифилис - это инфекция, передаваемая половым путем (ИППП). Заболевание вызывается спиралевидной бактерией – бледной трепонемой (Treponema pallidum). Сифилис часто называют «великим иммитатором», поскольку он имеет множество проявлений и его сложно отличить от других болезней.

Пути заражения сифилисом

Возбудитель передается при прямых половых контактах (вагинальный, оральный или анальный секс) от зараженных партнеров. Бактерия проникает через слизистые оболочки или поврежденную кожу при контакте с сифилитическими язвочками. Язвочки, вызванные болезнью, могут находиться на наружных гениталиях, во влагалище, на анусе и в прямой кишке. Также язвочки могут быть на губах и во рту. Беременные женщины могут заразить своего ребенка внутриутробно. Сифилис не передается через туалеты, дверные ручки, бассейны, ванны, одежду и посуду.

Проявления сифилиса

Часть зараженных могут не иметь проявлений сифилиса годами, однако это не снижает риска поздних серьезных осложнений, если они не получали лечения. Хотя заражение происходит через сифилитические язвочки от больных с первичным и вторичным сифилисом, у многих из них поражения кожи и слизистых не обнаруживаются. Таким образом, большинство заражений происходит от лиц, которые не знают о своей болезни.

Первичный сифилис

Первичная стадия сифилиса обычно проявляется одной или несколькими язвочками (так называемые шанкры). Период от заражения до появления клинических симптомов от 10 до 90 дней (в среднем 21 день). Обычно, шанкр бывает небольших размеров, округлым, плотным, красного цвета и безболезненным. Шанкр появляется в месте, где возбудитель сифилиса проникает в организм человека. Он может перейти в язвочку, которая выделяет прозрачную жидкость. Чаще шанкры находятся на половом члене, на анусе и в прямой кишке – у мужчин; во влагалище, на шейке матки, перианальной области – у женщин. Гораздо реже – на губах, во рту, на руках. Шанкры во влагалище и в прямой кишке могут не обнаруживаться при осмотрах врачом. Происходит увеличение (уплотнение) лимфатических узлов на внутренней стороне бедра и в паху. Шанкр существует от 3 до 6 недель и заживает без лечения. Однако, если правильное лечение не было назначено инфекция переходит вовторичный сифилис.

Вторичный сифилис

Вторичный сифилис проявляется в основном сыпью на теле или на видимых слизистых оболочках. Как правило, высыпания не сопровождаются зудом. Высыпания при вторичном сифилисе могут появиться во время заживления шанкра или через несколько недель после него. Высыпания обычно красные или красно-коричневые и появляются на ладонях рук и стопах. Однако, сыпь может проявлятся и на других частях тела, высыпания бывают похожи на сыпь, вызванную другими заболеваниями. Высыпания проходят без лечения через 2 - 6 недели. Кроме высыпаний, клинические проявления следующие - незначительное повышение температуры, увеличение лимфатических узлов, гнездное (частичное) облысение, боли в горле, головные боли, потеря веса, мышечные боли, боли в суставах и слабость. На этой стадии заболевание высокозаразно. Проявления вторичного сифилиса могут пройти и без лечения, но при этом заболевание переходит в поздний и скрытый сифилис.

Поздний сифилис

Поздняя (скрытая) стадия сифилиса начинается после проявлений вторичного сифилиса (через 1 – 2 года после заражения). Без лечения инфицированные лица остаются носителями заболевания, даже если у них нет проявлений болезни. На поздней стадии поражаются внутренние органы: головной мозг, нервы, глаза, сердце, кровеносные сосуды, печень, кости и суставы. Эти повреждения могут провится через много лет. Проявления включают – затруднения в координации движений, паралич, отсутствие чувствительности, постепенная слепота и слабоумие. Эти проявления чаще всего не излечимы. Описанные осложнения могут привести к смерти.

Действие сифилиса на беременную женщину и ее ребенка

Бледная трепонема может инфицировать плод во время беременности. В зависимости от того как долго беременная женщина была инфицирована сифилисом, беременность может привести к мертворождению («замершая беременность») в 25% случаев или к смерти новорожденного сразу после родов – 25 – 30% случаев. Инфицированные новорожденные могут родиться без признаков заболевания. Однако, без немедленного лечения новорожденные могут серьезно пострадать отсифилиса через несколько недель. Без лечения младенцы задерживаются в развитии или умирают.

Диагностика сифилиса

Диагноз первичного сифилиса ставится, если обнаруживается шанкр на половых органах, также проводится тщательный опрос пациента о его сексуальных контактах. Однако, часто больные не имеют никаких проявлений болезни.

Диагностика на ранней стадии может проводиться с использованием так называемой темнопольной микроскопии, в этом случае материал берется с шанкров и где и обнаруживается бледная трепонема.

Чаще всего диагностику сифилиса проводят с помощью специальных точных, безопасных тестов , материалом для исследования служит венозная кровь больного. В крови больного обнаруживаются антитела против бледной трепонемы, которые продуцирует иммунная система больного. Такие тесты называют также серологическими. Антитела появляются не ранее чем через 1 – 4 недели после появления шанкра. Низкий уровень антител может обнаруживаться в крови через месяцы и годы после успешно проведенного лечения. Поскольку нелеченый сифилис у беременных может привести к гибели плода, обследованию на сифилис подвергаются все беременные женщины.

Какая связь между сифилисом и ВИЧ – инфекцией?

Генитальные шанкры могут легко передавать ВИЧ-инфекцию (если больной инфицирован) здоровому человеку, а также быть «входными воротами» для вируса иммунодефицита человека в организм. Риск заражения ВИЧ увеличивается от 2 до 5 раз.

Лечение сифилиса

Сифилис легко излечим на ранних стадиях. Обычно применяется курс пенициллина, применяемого внутримышечно в иньекциях. Больных имеющим аллергию на пенициллин, лечат другими препаратами. Нет домашних средств или неоффициальных препаратов эффективных при сифилисе. Антибиотик убивает бледную трепонему и предотвращает развитие грозных осложнений, но не может восстановить ущерб, вызванный осложнениями. Поскольку эффективное лечение сифилиса на ранних стадиях существует, очень важно проводить обследование на сифилис лицам, имеющим частые беспорядочные половые контакты.

Больные, получающие лечение по поводу сифилиса, должны воздерживаться от незащищенных половых контактов пока шанкры и другие кожные повреждения полностью не заживут. Если у больного обнаружен сифилис, он должен сообщить об этом своим половым партнерам, для того чтобы они прошли полное обследование и соответствующее лечение.

Возможно ли повторное заражение?

Излечившиеся от сифилиса не защищены от повторного заражения. Поскольку шанкры могут быть скрыты во влагалище, в прямой кишке или во рту, без лабораторных тестов половые партнеры не могут быть уверены в здоровье друг друга.

Профилактика сифилиса

Наилучший путь профилактики инфекций, передаваемых половым путем (включая сифилис) – это долговременные половые контакты с одним здоровым половым партнером.

Уход от приема алкоголя и наркотиков, предотвращает заражение сифилисом, поскольку это уменьшает рискованое сексуальное поведение. Мужские презервативы из латекса, при условии защиты от генитальных язв и шанкров, снижают риск передачи сифилиса. Презервативы со смазкой, содержащей спермицид (ноноксинол -9) менее эфективны в плане защиты от ИППП. Последние научные исследования показали, что нонокснол-9 вызывает повреждение слизистых оболочек и облегчает проникновение ВИЧ и других ИППП, в том числе и бледной трепонемы. Центр по Контролю за заболеваемостью в г. Атланте (США) с июня 2001 года не рекомендует использование ноноксинола-9 в качестве спермицида или смазки во время анальных контактов.

Передача ИППП, включая сифилис, не может предотвращена мытьем половых органов, мочеиспусканием или принятием душа после секса.

Любые проявления, такие как выделения или необычная сыпь, особенно в паховой области являются сигналом для прекращения половых контактов и немедленного обследования в условиях специализированной клиники – КВД. Это снизит риск развития серьезных осложнений и предотвратит возможность повторного заражения.

 

сифак - это... Что такое сифак?

  • сифак — СИФ, а, СИФАК, а, СИФАЧОК, чка, СИФИЛЮЖНИК, а, СИФОН1, а, м., СИФИЛЮГА, и, СИФИЛЮЖКА, и, м. и ж. 1. Сифилис. Сифак схватить заболеть сифилисом. 2. То же, что сифилис …   Словарь русского арго

  • сифак — сл. компьютерный вирус Syn.: вирии, вирусяка, вирь, бацила, вир(я), живность, сифак, шуршун …   Hacker's dictionary

  • Сифак — …   Википедия

  • МАСИНИССА —    • Masinissa,          Μασανάσσης, сын восточно нумидийского царя Галы, воспитывался в Карфагене, где способный юноша имел возможность ознакомиться, между прочим, и с литературою греков и римлян. Cic. tusс. 3, 22. Nep. Hann. 13. Liv. 24, 49.… …   Реальный словарь классических древностей

  • Мезопропитеки — ? † Мезопропитеки …   Википедия

  • Семейство Индризиды (Indrisidae) —          Индризиды имеют длинные задние конечности, с помощью которых по земле передвигаются большими прыжками, при этом передние лапы вытягивают вверх или вперед. Пальцы с тыльной стороны покрыты волосами; на ногах они соединены кожной… …   Биологическая энциклопедия

  • сифилис — сифон, сифак, сифа, розочка, люис, красная шапочка, клубничка, генерал, (венерическая, французская) болезнь, чипок, чипилис, табес, чип, нечистота, негодная хворь, люэс, грязь, бытовуха Словарь русских синонимов. сифилис люэс; французская болезнь …   Словарь синонимов

  • сиф — СИФ, а, СИФАК, а, СИФАЧОК, чка, СИФИЛЮЖНИК, а, СИФОН1, а, м., СИФИЛЮГА, и, СИФИЛЮЖКА, и, м. и ж. 1. Сифилис. Сифак схватить заболеть сифилисом. 2. То же, что сифилис …   Словарь русского арго

  • сифачок — СИФ, а, СИФАК, а, СИФАЧОК, чка, СИФИЛЮЖНИК, а, СИФОН1, а, м., СИФИЛЮГА, и, СИФИЛЮЖКА, и, м. и ж. 1. Сифилис. Сифак схватить заболеть сифилисом. 2. То же, что сифилис …   Словарь русского арго

  • сифилюга — СИФ, а, СИФАК, а, СИФАЧОК, чка, СИФИЛЮЖНИК, а, СИФОН1, а, м., СИФИЛЮГА, и, СИФИЛЮЖКА, и, м. и ж. 1. Сифилис. Сифак схватить заболеть сифилисом. 2. То же, что сифилис …   Словарь русского арго

  • Как не подхватить сифилис и что делать, если заразились

    Сифилис — одна из инфекций, передающихся половым путём (ИППП). Причём крайне коварная. По двум причинам.

    Во-первых, сифилис очень заразен. Несмотря на то, что чаще всего он передаётся при незащищённом сексе, включая анальный и оральный, в некоторых случаях инфекцию можно подцепить и без интима — при долгих поцелуях или слишком тесных объятиях. Ещё один путь передачи — от инфицированной матери к плоду или новорождённому ребёнку.

    Во-вторых, сифилис малозаметен. По крайней мере, на ранних стадиях. Заражённый им человек может искренне не догадываться, что является переносчиком опасной инфекции, и награждать ею своих секс-партнёров.

    Что такое сифилис и чем он опасен

    Сифилис — это бактериальная инфекция, которую вызывает микроб с неприятным названием бледная трепонема (Treponema pallidum). Трепонема атакует организм постепенно. Начинает с кожи и слизистых оболочек, а затем распространяется на все жизненно важные органы и системы. Может развиться сифилис лёгких, желудка или нервной системы.

    Ещё сотню-две лет назад сифилис являлся одной из главных угроз общественному здоровью, унося и калеча миллионы жизней. Благодаря развитию медицины заразу удалось усмирить. Но она всё равно проявляет себя.

    Только в США ежегодно фиксируется более 100 тысяч новых случаев заболевания.

    Если его не лечить, рано или поздно это приведёт к серьёзным осложнениям . Вот лишь некоторые из них:

    • язвы, эрозии, твёрдые наросты на коже;
    • снижение иммунитета;
    • деформация костей и суставов, в том числе обезображивающая внешний вид;
    • нарушения зрения вплоть до слепоты;
    • болезни сердца и сосудов — до инфарктов, инсультов, аневризмы аорты;
    • неврологические поражения вплоть до развития психических расстройств и деменции;
    • поражения внутренних органов;
    • паралич.

    Ситуация ещё печальнее, если речь идёт о беременной женщине, заражённой сифилисом. Её будущий ребёнок имеет высокий риск погибнуть ещё до родов или вскоре после них.

    Всех этих ужасов можно избежать. Сифилис на сегодня — излечимое заболевание с быстрой диагностикой. Главное — начать терапию вовремя, не доводя дело до необратимых повреждений организма.

    Как распознать сифилис

    Даже несмотря на малозаметность, обнаружить сифилис всё же можно в том числе на ранних стадиях — достаточно проявить чуть внимательности и не расслабиться, когда болезнь внезапно «пройдёт».

    Первый симптом заболевания — небольшой узелок, папула, язвочка или иная ранка, которая появляется на половых органах, в анальном проходе или во рту. Рану легко проигнорировать: её можно увидеть или пощупать, но она не болит и не доставляет дискомфорта. Да ещё и в течение нескольких недель заживает без следа.

    Если подобная ранка появилась спустя 10–90 дней после незащищённого секса, её обязательно надо показать врачу. Даже если она кажется вам абсолютно безобидной.

    Зажившая язва или исчезнувшая папула вовсе не говорят о том, что болезнь растворилась. Бактерии остаются в организме и продолжают размножаться. Латентная (незаметная) фаза может длиться годами, прежде чем проявить себя опасными осложнениями. Впрочем, иногда настораживающие симптомы всё же возникают дополнительно.

    Так, вторичную стадию заболевания, которая начинается в период от шести недель до полугода после заражения, можно распознать по следующим признакам:

    • Достаточно крупная розовая сыпь. Как правило, она возникает на ладонях и подошвах.
    • Лёгкий зуд и высыпания (в том числе совсем незначительные) на других частях тела.
    • Белые пятнышки на слизистой рта.
    • Влажные прыщи в паховых складках.
    • Увеличение лимфатических узлов.
    • Лихорадка.
    • Потеря веса.

    Эти симптомы могут быть смазанными до такой степени, что от них легко отмахнуться. К тому же, как и признаки ранней стадии сифилиса, они исчезают сами собой в течение максимум трёх месяцев.

    Далее болезнь снова переходит в латентную фазу. Чтобы однажды проявиться третичной фазой и нанести удар (возможно, смертельный) по здоровью.

    Что делать при сифилисе или подозрении на него

    Если у вас есть хотя бы малейшие опасения, обязательно обратитесь к терапевту или дерматовенерологу. Медик выдаст вам направление на необходимые исследования, которые помогут подтвердить или исключить заболевание. Как правило, речь об анализе крови и соскобе с кожи или слизистых оболочек, если на них появились поражения.

    Сделать анализ на сифилис можно и самостоятельно в любой медицинской лаборатории. Но есть важный нюанс: зафиксировать бледную трепонему получится лишь спустя некоторое время после заражения. Бежать проверяться сразу после подозрительного полового акта бессмысленно. И лучше, выбирая срок и вид анализа, довериться врачу.

    Как лечить сифилис

    Лечится заболевание просто — антибиотиками. Как правило, на основе пенициллина, но возможны варианты.

    Терапию важно проводить только по назначению дерматовенеролога. По двум причинам. Во-первых, самолечение не гарантирует выздоровления. Может оказаться, что вы просто загнали инфекцию вглубь и она продолжит развиваться. Во-вторых, каждая стадия сифилиса требует собственной схемы терапии. Те методы и препараты, которые будут эффективны на начальной стадии, окажутся беспомощны на вторичной и тем более третичной.

    Учтите: антибиотики смогут изгнать бледную трепонему из организма. Но они не устранят тот ущерб, который инфекция уже нанесла.

    Поэтому в ваших интересах сделать всё, чтобы не заразиться сифилисом.

    Как не заразиться сифилисом

    К сожалению, это достаточно сложная задача. Как сообщает американский Центр по контролю и профилактике заболеваний, единственный более-менее эффективный способ избежать заражения — вообще не заниматься вагинальным, анальным или оральным сексом. Но и при этом всё равно остаётся риск подцепить инфекцию при поцелуях или объятиях.

    Вот что, по мнению медиков, поможет снизить риски.

    • Выбирайте взаимно моногамные отношения с партнёром, который прошёл проверку на сифилис.
    • Используйте средства барьерной контрацепции, если вы не уверены на 100%, что ваш партнёр здоров. Не забывайте о презервативах в том числе и при оральных контактах.
    • Воздерживайтесь от случайного секса.
    • Не делитесь и не меняйтесь секс-игрушками с другими людьми.
    • Избегайте употребления алкоголя и наркотиков. Потенциально они могут толкнуть на опасные секс-эксперименты с незнакомцами.

    Обязательно поговорите с врачом или самостоятельно сдайте анализы на ИППП и сифилис в том числе, если:

    • у вас был незащищённый секс с плохо знакомым партнёром;
    • интим случился с новым сексуальным партнёром, в котором вы не уверены;
    • у вас несколько секс-партнёров;
    • у вас или у вашего партнёра появились высыпания, язвочки, дискомфорт в области половых органов или слизистых.

    И напоследок ещё один важный момент. Иммунитета от сифилиса не существует. Излечившись от этой болезни, вы можете подхватить её вновь. Будьте благоразумны и осторожны.

    Читайте также 🚑❤🌱

    Сифилис - понятие и значение


    Рассмотрим что означает понятие и значение слова сифилис .

    Сифилис это - 1. Инфекционное венерическое заболевание, вызываемое особым микроорганизмом - бледной трепонемой.

    Сифилис это - Инфекционная венерическая болезнь.

    Сифилис это - 1. Сифилиса, множественное число нет, (м единственное число ). Заразная венерическая болезнь, тяжелая по своим последствиям, вызываемая особым микроорганизмом, так называемый бледной спирохетой, то же, что люэс. (По имени Siphilus ( греческое sys - свинья и philos - друг), персонажа средневековой латинской поэмы.)

    СИФИЛИС

    (Венерическая болезнь) общее заболевание организма, происходящее от заражения особым сифилитическим ядом; заражение происходит как половым, так и вне половым путем - при попадании отделений сифилитиков на ранки тела или на слизистую оболочку; явления сифилиса делятся на первичные, вторичные и третичные. Лечение с-а очень медленное. Многие считают с. неизлечимым.

    СИФИЛИС

    ( греческое ). Любострастная конституциональная болезнь, отличается заразительным характером и упорным течением.

    СИФИЛИС

    греческое , болезнь в средних веках; от sys, свинья, и philos, друг. То же, что венерическая.

    СИФИЛИС

    так называемая «дурная болезнь», ужасна по своим последствиям; лечению поддается туго и медленно; в виду некоторых особенностей самой болезни, и также средств борьбы с нею, излечение является редк именительный падеж С. очень заразителен; передача возможна не только половым путем, но и иначе, когда к. кто-нибудь выделение сифилитика (слюна, моча, отделения из носа) попадет хотя бы на самую незначительною царапинку на теле здорового или на слизистую оболочку. Поэтому ни целоваться ни есть или пить из одной посуды с больным сифилисом отнюдь не следует.

    -а, м.

    Заразная венерическая болезнь, вызываемая бледной спирохетой; люэс.

    {По имени действующего лица латинской средневековой поэмы Syphilus}


    Часть речи


    Имя существительное

    Словоформы


    сифилиса, сифилису, сифилисом, сифилисе, сифилисы, сифилисов, сифилисам, сифилисами, сифилисах

    Синонимы wiki


    генерал, болезнь, грязь, бытовуха, нечистота, венерическая болезнь, негодная хворь, дюкер, аэролифт, эрлифт, ливер, термосифон, трубка, насос, сквозняк, милиционер, сиф, сифон, клубничка, чип, розочка, сифак, венерический, французская болезнь, чипок, чипилис, табес

    См.

    также

    ... незаметно , что позорное слово "бандит " стало объектом всеобщего уважения " Развенча - 1 Сифилис , он и в Серпухове сифилис //Вечерняя Москва 1996 , 7 июня ние атрибутики преступного ... ... слово "бандит " стало объектом всеобщего уважения " Развенча - 1 Сифилис , он и в Серпухове сифилис //Вечерняя Москва 1996 , 7 июня ние атрибутики преступного мира , образа ... (Криминальная психология)

    ... -БАБА - женщина , владеющая мужской профессией ЭРЗАЦ -ПЕСОК - поваренная соль ЭСЕС - сифилис ЭСЕСОВКА - женщина -надзиратель в ИУ ЭСКАЛАЦИЯ - применение силы агрессивными заключенными (например ... (Криминальная психология)

    ... сношения ХАРКА - любовница ХАРКОТА (ХАРКОТИНА ) - совесть ; плевок зека , больного туберкулезом или сифилисом ХАРТАН - продуктовая передача осужденному ХАРЧЕВНЯ - столовая ХАТА - воровской притон ; надежная .. . (Криминальная психология)

    ... к брачному сожитию , наступившую до брака или явившуюся следствием намеренного самокалечения , заболевание проказой или сифилисом , длительное безвестное отсутствие , осуждение к наказанию , соединенному с лишением всех прав состояния ... (Межличностные отношения)

    ... система (парк ) - круг изготовителей , гонцов , перекупщиков и потребителей наркотиков сифа , сифон - сифилис сифонить - доносить сичка - бирка на кровати осужденного сказаться дома - не оказывать ... (Криминальная психология)

    ... ног спящего заключенного ВЕЛОЧКА - нормально ВЕЛЬМОЖА - начальник ОВД (УВД ) ВЕНЕРА - сифилис ; подарок ВЕНЕЦ - суд ВЕНИК - наблюдатель ; гитара ; венерический больной ; недотепа ВЕНИК ... (Криминальная психология)



    Синонимы к слову СИФ в словаре синонимов, похожие слова.

    К сожалению, мы не нашли прямых синонимов для слова «сиф», однако нашли 11 слов, близких по значению:

    1СИФИЛИС С ЕД, ИМ, МР, НО

    0  0 

    2БОЛЕЗНЬ С ЕД, ЖР, ИМ, НО

    0  1 

    3БЫТОВУХА С ЕД, МР, ОД, РД

    0  0 

    4ГРЯЗЬ С ЕД, ЖР, ИМ, НО

    1  0 

    5ЛЮЭС С ЕД, ИМ, МР, НО

    0  0 

    6СИФАК С ЕД, ИМ, МР, НО

    0  0 

    7ТАБЕС С ЕД, ИМ, МР, НО

    0  0 

    8ЧИП С ЕД, ИМ, МР, НО

    0  0 

    9ЧИПОК С ЖР, МН, НО, РД

    0  0 

    10ВЕНЕРИЧЕСКАЯ БОЛЕЗНЬ С ЕД, ЖР, ИМ, НО

    0  0 

    11НЕГОДНАЯ ХВОРЬ С ЕД, ЖР, ИМ, НО

    0  0 

    Физтеховский толковый словарь

    Физтеховский толковый словарь

    Старые слова

    • физтех — студент и выпускник МФТИ (В отличие от названия института (Физтех) пишется с маленькой буквы) (уважительный тон). Физтехами также могут называть не закончивших обучение. Женск. физтешка (это не только название студентки, но, зачастую, самоназвание жён физтехов).
    • Мужик — обращение одного физтеха к другому.
    • Секарь (варианты: Сёкарь, Секан, Секандр) — толковый студент (уважительно).
    • Сечь (секу, сечешь, сечет) — досконально понимать какую-либо науку, разбираться в ней.
    • Невол — бестолочь (уничижительно).
    • Оргазм — синоним слова «хорошо».
    • Сиф (варианты: сифак, сифон) — грязь, беспорядок.
    • Порнография — безобразие.
    • Долгопа — Долгопрудный.
    • Пригород — Москва.
    • Придаток — МГУ (уничижительный тон). Иногда — ГУМ.
    • Зюзька — московское общежитие МФТИ для старшекурсников и аспирантов (неподалёку от Зюзино).
    • Стекляшка — московский корпус ФПФЭ, рядом с ИКИ.
    • База — базовая кафедра.
    • Лаба — лабораторная работа.
    • Лабник — сборник лабораторных упражнений по физике, а также преп, ведущий лабы.
    • Кирпич (устар.) — Учебник истории КПСС. Он же — Серая лошадь.
    • Война — занятия по военной подготовке. Реальный случай: телеграмма в начале учебного года задерживающемуся дома студенту от однокурсника: «Картошки не будет война в среду= Потапов-».
    • Ландафшиц (редкий вариант: Ландаушиц, Ландлифчик) — Курс теоретической физики Ландау и Лифшица; тома 9 и 10 также называют Питаевшиц.
    • Беклеметрия — название курса аналитической геометрии для первокурсников, а также основного учебника (по автору и лектору курса — Д. В. Беклемишеву).
    • Айзермех — классический учебник М. А. Айзермана по теоретической механике. С Гантмахером не путать! На слова «Как писал покойный Айзерман…» лектор Айзерман обоснованно возражал: «Это не у меня, а у Гантмахера!»
    • Паяльники — студенты ФРТК.
    • Топоры — студенты ФОПФ (с весны 1983 г., с тех же пор «профсоюзные» крючки в туалетах и поговорка «ФОПФов бояться — с…ать не ходить»).
    • Факиры — студенты ФАКИ.
    • ФизХамы — студенты ФМХФ.
    • Кванты — студенты ФФКЭ.
    • Приматы — студенты ФУПМ.
    • Проблемы — студенты ФПФЭ.
    • Зеркальная болезнь — эвфемизм «ожирения» (употр. по отношению к мужчинам). Имеет место тогда, когда человек может видеть свои гениталии только с помощью зеркала. В случае, если одного зеркала мало, имеет место зеркальная болезнь 2-й, 3-й и т. д. степени, по количеству нужных зеркал.
    • Спиногрыз — более доброжелательный аналог старого русского слова «захребетник». Слово распространено широко, но в физтеховских кругах было в ходу также произношение спинОгрыз, которое отличалось недоброжелательностью.
    • Бакланы — соседи-студенты, которые устраивают гулянку в ночь на день, когда у тебя какая-нибудь важная сдача. Присваивается практически пожизненно.
    • Шарить — понимать. Зашарить — изучить, разобраться в какой-либо теме.
    • Фачить (от англ. fuck) — заваливать (наст.время, незаверш.форма) на экзамене.
    • Тошня, тошняк, тошниловка — столовая на ул. Первомайская (д.7, 2-й этаж).
    • Боталка — комната для самоподготовки в общежитии.
    • Серж — С. П. Капица.
    • Гога — И. А. Борачинский.
    • Три «Б» — тройка самых нехалявных преподавателей: Борачинский, Беклемишев, Бесов.
    • Занаука — институтская еженедельная газета «За науку», а также номер этой газеты.
    • Клуб четырёх коней — кафедра высшей математики.
    • Двадцатка — ближайший (официальный) сумасшедший дом.
    • ЧМО — Чисто Мужское Общество.

    Неологизмы

    • Мамонт — Двух- и более ярусная кровать ручной сборки. Мамонты были крайне актуальны после пожара в 4 общежитии в феврале 1998 года, когда число проживающих в некоторых комнатах с учетом переселенцев доходило до 6 - 7 человек.
    • Чернильница — Корпус прикладной математики МФТИ.
    • Доды — (уничижительный тон) студенты, которые плохо следят за своей гигиеной и/или неадекватны в жизни (ед. число — дод).
    • Додвей — уничижительное название фаст-фуда Subway, открывшегося рядом с МФТИ летом 2007 года.
    • Бот — учеба (как правило, домашняя, вне стен института).
    • Ботать — учиться, решать задания. В более общем смысле овладевать какими-либо знаниями и навыками. Производные: заботался (устал от долгой и напряженной учебы), недоботал (недоучил, плохо подготовился) и др.
    • Ботан — студент, посещающий все лекции/семинары и вовремя выполняющий все задания. Женск. ботанша Заимствовано из подросткового сленга. В отличие от подростковой среды, на сленге физтехов слово не носит пренебрежительного характера.
    • Читалка — читальный зал библиотеки в Главном корпусе.
    • Дебильник — минимальный список вопросов к экзамену.
    • Задавальник — брошюра со списком заданий, выдаваемая студентам каждый семестр.
    • Шар — толковый студент (уважительно).
    • Мегашар — очень толковый студент (уважительно).
    • Расшарить — объяснить что-либо. Слово появилось в момент расцвета компьютерной сети и происходит от английского share — разделять (или от шарить — см. выше). Получилось путем обобщения фразы «Расшарь мне файл» и теперь имеет смысл делиться знаниями.
    • Факер (транскрипция англ. fucker, от fuck) — нехалявный преподаватель, спрашивающий «от и до», противоположность халявщику.
    • Рюхать — сходно с сечь и шарить, но с налётом трансцедентного, интуитивного понимания изученного материала, в отличие от кропотливо зашаренного.
    • Халявщик — преподаватель, ставящий несколько завышенную оценку, по сравнению с объективными знаниями студента. Спрашивает не по всему курсу предмета, но по малой части; если видит, что студент это знает, то не продолжает спрашивать дальше, а ставит отметку. Также часто «вытаскивает» студента, спрашивая в надежде найти ту область знаний, в которой тот хоть что-то знает.

    Некоторые стили внешности

    • "Военный"— короткая стрижка (иногда наголо), зелёная «военторговская» рубашка, «…и в галстуке» (зелёный галстук-"селёдка")
    • "Гамер" — длинные, нечёсаные волосы, одежда любая, редко появляется на людях
    • "Сносная" (устар.) — телогрейка с пришитыми вместо пуговиц пятаками (пятаки прочнее, а пробитые лазером отверстия не так режут нитки). Одежда на «снос» (способ добывания дефицитных билетов в театры)
    • "На футбол" — рваные и грязные тренировочные брюки и футболка. Студенток других институтов крайне удивляло, как люди могут вообще выходить в подобной одежде в общественное место
    • "Зимой и летом одним цветом" — джинсы, свитер, штормовка — повседневная одежда для общаги и института (кроме дней, когда приходилось носить зелёную «селёдку»)

    лемуров сифака занесены в список «находящихся под угрозой исчезновения» из-за загадочного вымирания

    • За последние полтора месяца по крайней мере 31 сифака Верро (Propithecus verreauxi) умер в заповеднике Беренти недалеко от южной оконечности Мадагаскара.
    • Это одна из самых крупных случаев гибели лемуров, которую могут вспомнить ученые.
    • Эксперты считают, что виноваты паразиты или клещевые заболевания, но точная причина остается неизвестной.
    • На большом заседании МСОП, состоявшемся на прошлой неделе в Антананариву, столице Мадагаскара, специалисты по приматам решили вынести все девять видов сифака от вымирающих до находящихся под угрозой исчезновения.

    Лемуры на Мадагаскаре уже много лет находятся под давлением вырубки лесов, браконьерства, засухи и других проблем. Теперь в очень посещаемом заповеднике Беренти у южной оконечности острова один вид сталкивается с новой загадочной угрозой.

    За последние полтора месяца в заповеднике умерла по крайней мере 31 сифака Верро ( Propithecus verreauxi ). Большинство из них были найдены уже мертвыми; другие были обнаружены тяжело больными и позже умерли от дыхательной недостаточности. Сотрудники Berenty и местные ученые обратились к ветеринарам и приматологам со всего мира.Эксперты считают, что, скорее всего, виноваты паразиты или клещевые заболевания, но точная причина остается неизвестной.

    Это одно из самых крупных случаев гибели лемуров, которое могут вспомнить ученые на Мадагаскаре. «Мы не видели ничего подобного раньше», - сказала Mongabay Патрисия Райт, эксперт по лемурам и основательница Centre ValBio, исследовательского центра на востоке центральной части Мадагаскара.

    Сифака Верро (Propithecus verreauxi). Изображение Ретта А. Батлера.

    Сифаки Верро боролись задолго до этой вспышки.Белые пушистые лемуры уже были внесены в список находящихся под угрозой исчезновения Международного союза охраны природы (МСОП). По данным МСОП, популяция сильно фрагментирована и сокращается на протяжении десятилетий. Вид обитает в засушливых районах и колючих лесах юго-запада Мадагаскара.

    По совпадению, на прошлой неделе в Антананариву, столице Мадагаскара, состоялось большое совещание группы специалистов по приматам Красного списка МСОП, и одним из главных пунктов повестки дня была переоценка статуса опасности для всех видов лемуров.По словам присутствующих, группа решила внести в список все девять видов сифака, от вымирающих до находящихся под угрозой исчезновения. Изменение статуса еще не является официальным, но во время встречи на странице Facebook проекта сети по сохранению лемуров этой группы было упомянуто: «Нам очень грустно сообщать, что все виды сифака теперь подпадают под критерии критически исчезающих видов».

    Сифаки Верро путешествуют группами до 14 человек, и по крайней мере две из этих групп были уничтожены в Беренти с конца марта.Беренти - это частный заповедник, которым управляет французская семья, владеющая местным бизнесом по производству сизаля. На протяжении десятилетий он был местом исследований и популярным местом для экотуризма. Лемуры - главная достопримечательность.

    Ученые собрали воедино ключи к разгадке причины смерти, оценив пораженные сифаки, которые были найдены еще живыми. У некоторых из этих сифаков были парализованы задние лапы; чтобы двигаться, им приходилось волочиться за руки по лесной подстилке. (Как правило, сифаки Верро имеют мощные задние лапы, которые позволяют им отскакивать боком о землю или прыгать на 3 метра или 10 футов с дерева на дерево.) В течение дня в большинстве случаев паралич переместился вверх по телу и попал в легкие, вызывая смерть от дыхательной недостаточности.

    Сифаки Верро в горячей территориальной погоне. Изображение Ретта А. Батлера.

    Большинство мертвых сифаков были обнаружены покрытыми клещами, которые, по мнению ученых, могли вызвать паралич, передавая сифакам нейротоксин или какой-либо тип инфекционных риккетсиозных бактерий. Однако в 2014 году ученые обнаружили, что многие другие сифаки Верро покрыты клещами, и у них не было никаких признаков болезни.

    Другая возможность заключается в том, что недавние смерти были вызваны одноклеточными паразитами токсоплазмы, которые поражают нервную систему и которые, как и риккетсиозные бактерии, могли быть занесены в этот район людьми. Паразиты могли находиться в местной почве или в кошачьем навозе. Образцы тканей и органов тел мертвых сифак были отправлены в Институт Пастера Мадагаскара в Антананариву, но результаты тестов еще не получены.

    Почти все мертвые сифаки были мужчинами, и это сначала заставило ученых поверить, что, возможно, смерть произошла из-за агрессивных территориальных споров.Поскольку внешние угрозы вынудили сифаков Верро и других видов лемуров скапливаться на небольших территориях, это неудивительно. «Когда мы нашли первые 9 [мертвых сифак], мы подумали, что это могло быть связано с перенаселенностью», - сказала Mongabay Клэр Фулон, менеджер резерва. Однако на трупах не было никаких следов насилия, и эта теория теперь опровергнута. Эксперты не уверены, почему большинство погибших сифаков - мужчины.

    Сифака Верро кормит ребенка. Изображение Ретта А. Батлера.

    Какой бы ни была причина болезни, другие виды лемуров не столь уязвимы для нее, как сифаки Верро. Пока что ни один из многих кольчатых лемуров ( Lemur catta ) в том же районе не пострадал. Однако один коричневый лемур (род Eulemur ) был найден мертвым, очевидно, от той же болезни.

    С 30 апреля сифаки не были обнаружены больными или мертвыми, поэтому эксперты надеются, что худшее может быть позади. «Поскольку большинство новостей указывают на это локализованное событие в рамках графика, я надеюсь, что все, что стало причиной 37 смертей (это число, которое обсуждалось на встрече МСОП), прошло своим чередом», - сказал Эдвард Луи, директор НПО Мадагаскарское партнерство по биоразнообразию и директор отдела природоохранной генетики Университета им.Зоопарк и аквариум Генри Дурли из Омахи в Южной, говорится в электронном письме Монгабаю. (Луис и другие эксперты назвали число погибших около тридцати лет, но Фулон, менеджер резерва, позже сказал Монгабаю, что во время вспышки умерла только 31 сифака.)

    Команда ветеринаров из Германии сейчас находится на месте, чтобы поддержать малагасийского ветеринара, работающего над этим случаем.

    Танец сифаки Верро. Изображение Ретта А. Батлера.

    ОБРАТНАЯ СВЯЗЬ: Используйте эту форму, чтобы отправить сообщение редактору этого сообщения.Если вы хотите опубликовать публичный комментарий, вы можете сделать это внизу страницы.

    Животные, Биоразнообразие, Кризис биоразнообразия, Сохранение, Вырубка лесов, Экосистемы, Вымирающие виды, Окружающая среда, Вымирание, Фрагментация лесов, Леса, Среда обитания, Деградация среды обитания, Разрушение среды обитания, Охота, Лемуры, Лесозаготовки, Млекопитающие, Парки, Приматы, Охраняемые районы, Тропические леса, Исследования, Тропические леса, Дикая природа, Сохранение дикой природы

    ПЕЧАТЬ

    Почти треть лемуров и североатлантических китов в настоящее время находятся под угрозой исчезновения - Красный список МСОП

    Красный список МСОП на сегодняшний день превысил 120 000 видов, в настоящее время оценивается 120 372 вида.Из них 32 441 человек находится под угрозой исчезновения.

    «Это обновление Красного списка МСОП раскрывает истинный масштаб угроз, с которыми сталкиваются приматы по всей Африке. Это также показывает, что Homo sapiens нуждается в радикальном изменении своего отношения к другим приматам и к природе в целом », - сказала д-р Гретель Агилар, исполняющая обязанности Генерального директора МСОП. «В основе этого кризиса лежит острая необходимость в альтернативных, устойчивых источниках средств к существованию, чтобы заменить нынешнюю зависимость от обезлесения и нерационального использования дикой природы.Эти результаты действительно подтверждают острую необходимость в амбициозной рамочной программе сохранения биоразнообразия на период после 2020 года, которая будет стимулировать эффективные природоохранные меры ».

    «Резкое сокращение численности видов, таких как североатлантический кит, включенного в сегодняшний обновленный Красный список МСОП, подчеркивает серьезность кризиса исчезновения», - сказала д-р Джейн Смарт, Глобальный директор Группы по сохранению биоразнообразия МСОП . «Спасение быстро растущего числа угрожаемых видов от исчезновения требует трансформационных изменений, подкрепленных действиями по выполнению национальных и международных соглашений.Мир должен действовать быстро, чтобы остановить сокращение популяции видов и предотвратить вымирание, вызванное деятельностью человека, с помощью амбициозной программы сохранения биоразнообразия на период после 2020 года, которую поможет определить предстоящий Конгресс МСОП »

    Почти треть видов лемуров на грани исчезновения

    Сегодняшнее обновление показывает, что 33 вида лемуров находятся под угрозой исчезновения, а 103 из 107 сохранившихся видов находятся под угрозой исчезновения, в основном из-за вырубки лесов и охоты на Мадагаскаре. Тринадцать видов лемуров были переведены в категорию более высоких угроз в результате усиления антропогенного давления.Среди тех, кто недавно был внесен в список находящихся под угрозой исчезновения, - сифака Верро ( Propithecus verreauxi ) и мышиный лемур мадам Берты ( Microcebus berthae ), самые маленькие приматы в мире, оба из которых ранее были внесены в списки вымирающих. Эти виды подвергаются значительному сокращению, поскольку их лесные среды обитания продолжают разрушаться в результате подсечно-огневого земледелия, а также заготовки древесного угля и дров. Охота также угрожает сифаке Верро, несмотря на то, что она незаконна и рассматривается как табу или «фейри» во многих частях ее ареала.

    В других частях Африки около 53% видов приматов (54 из 103) в настоящее время находятся под угрозой исчезновения. Сюда входят все 17 видов красных колобусов, что делает его самым угрожаемым видом обезьян на континенте. Среди приматов, получивших сегодня более высокий статус угрозы, есть король колобус ( Colobus polykomos ), обезьяна, живущая на западном побережье Африки, которая перешла из уязвимого в исчезающий. Охота на мясо диких животных - по большей части незаконная - и потеря среды обитания по-прежнему представляют собой самую серьезную угрозу для приматов на всем континенте.

    «Благодаря очень успешной стратегии МСОП по сохранению лемуров, разработанной нашей группой специалистов по приматам SSC МСОП, мы смогли собрать более 7,5 миллионов долларов США для Инициативы МСОП« Спасем наш вид лемуров ». Благодаря этим средствам местные организации теперь неустанно работают над развитием экотуризма, созданием новых охраняемых территорий на базе сообществ, а также патрулированием, восстановлением лесов и повышением осведомленности в школах и местных сообществах о необходимости защиты лемуров, сокровища Мадагаскара. Хотя ситуация остается очень серьезной для большинства видов лемуров, справедливо сказать, что некоторые из них, такие как сильно истощенный северный спортивный лемур ( Lepilemur septentrionalis ), могли бы уже вымереть, если бы не эти инвестиции », - сказал Расс Миттермайер, председатель Группы специалистов по приматам Комиссии по выживанию видов МСОП .

    Североатлантический кит в шаге от исчезновения

    Североатлантический кит ( Eubalaena glacialis ) был перемещен из Красного списка МСОП из категории «Вымирающие» в «Критически исчезающие». По оценкам, на конец 2018 года было живым менее 250 половозрелых особей, общая численность популяции сократилась примерно на 15% с 2011 года. Это снижение вызвано сочетанием повышенной смертности из-за попадания в рыболовные снасти и ударов судов, а также более низкий коэффициент воспроизводства по сравнению с предыдущими годами.Из 30 подтвержденных человеческих смертей или серьезных травм североатлантических китов в период с 2012 по 2016 год 26 были связаны с запутыванием.

    Изменение климата, похоже, усугубляет угрозы для североатлантических китов. Более высокая температура моря, вероятно, подтолкнула их основные виды добычи летом дальше на север, в залив Св. Лаврентия, где киты более подвержены случайным столкновениям с кораблями, а также подвергаются высокому риску запутаться в веревках ловушки для крабов.

    Европейский хомяк в критической опасности

    Европейский хомяк ( Cricetus cricetus ), когда-то обитавший в Европе и России, сильно сократился в популяциях по всему ареалу и теперь занесен в Красный список МСОП как находящийся под угрозой исчезновения.Исследования показали, что сокращение численности населения, вероятно, связано со снижением темпов воспроизводства. В то время как самка хомяка рожала в среднем более 20 детенышей в год на протяжении большей части -го и века, сегодня было установлено, что самки рожают только 5-6 детенышей в год. Причины снижения темпов воспроизводства еще полностью не поняты, но в качестве возможных причин исследуются расширение монокультурных плантаций, промышленное развитие, глобальное потепление и световое загрязнение.

    В результате грызун исчез с трех четвертей своего первоначального ареала во французском регионе Эльзас, по крайней мере с трети его ареала в Германии и более чем с 75% его ареала в Восточной Европе. Если ничего не изменится, ожидается, что этот вид вымрет в течение следующих 30 лет.

    Самый дорогой гриб в мире под угрозой

    Самый дорогой гриб в мире, гусеничный гриб ( Ophiocordyceps sinensis ), внесен в Красный список МСОП как уязвимый.Этот гриб высоко ценится в традиционной китайской медицине, где его уже более 2000 лет используют для лечения многих заболеваний, в том числе заболеваний почек и легких. Спрос на гриб резко вырос с 1990-х годов.

    Caterpillar Fungus, который растет только на Тибетском плато, паразитирует на личинках бабочек-призраков, когда они хоронят их под землей. Затем он прорастает через их тела и через головы личинок выходит на поверхность, где и собирается.

    За последние два десятилетия гриб стал основным источником средств к существованию для тысяч людей там, где он встречается.Популяции Caterpillar Fungus сократились как минимум на 30% за последние 15 лет в результате чрезмерного вылова.

    Скачать фото и сводную статистику можно здесь.

    ###

    Подтверждающих цитат:

    «Хотя природоохранные меры, включая благоприятное для хомяков управление полями и реинтродукцию, замедлили сокращение популяции в некоторых районах, они не смогли повернуть вспять тенденцию», - сказал д-р Михаил Русин, автор новой оценки Красного списка, член Группа специалистов по малым млекопитающим ГНЦ МСОП и руководитель проекта восстановления хомяков в Киевском зоопарке, Украина .«В дополнение к этим мерам срочно необходимы дополнительные исследования различных возможных причин исчезновения европейского хомяка, чтобы спасти его от исчезновения».

    «Это один из немногих задокументированных случаев, когда грибку угрожает чрезмерный сбор», - сказал профессор Грегори Мюллер, председатель Комитета по сохранению грибов SSC МСОП. «Осуществление устойчивой программы сбора урожая необходимо как для китайского грибка Caterpillar, так и для долгосрочного экономического благополучия сообществ, доходы которых зависят от него.«

    «Лемуры прочно находятся в поле зрения защитников природы, но потребуются дальнейшие инвестиции в их сохранение, чтобы обратить вспять их упадок», - сказал профессор Джон Пол Родригес, председатель Комиссии по выживанию видов МСОП . «Движущие силы исчезновения видов сложны и действенны, поэтому наша реакция должна быть сопоставимой по интенсивности. В некоторых случаях, таких как лемуры и гусеницы, их угрозы известны и понятны. У других, например у европейского хомяка, картина более неопределенная.Ясно то, что МСОП идеально расположен для накопления опыта и знаний, необходимых для того, чтобы вернуть виды с пропасти. Включение в Красный список видов, находящихся под угрозой исчезновения МСОП, является первым шагом в процессе систематического планирования наилучших мероприятий, связанных с достижением успешных природоохранных мероприятий. Мы знаем, как это сделать, нам просто нужно делать больше ».

    «Посредством проектов МСОП« Спасем наш вид »мы устраняем основные угрозы выживанию лемуров, такие как подсечно-огневое земледелие, незаконные рубки леса, а также охота и содержание лемуров в качестве домашних животных.Мы также работаем, чтобы поддержать местные общины в развитии средств к существованию, обеспечивающих устойчивое использование природных ресурсов », - сказала Ана Нието, глава Международного союза охраны природы« Сохраним наш вид ». «Около 40% первоначального лесного покрова Мадагаскара потеряно между 1950-ми и 2000 годами, поэтому лесовосстановление имеет решающее значение для защиты всех видов лемуров. С 2017 года в рамках наших проектов было посажено более 2,7 миллиона деревьев для улучшения среды обитания лемуров по всему острову ».

    «Поскольку Красный список МСОП превышает 120 000 видов, он становится еще более сильным барометром жизни.Оценка 4260 видов животных, грибов и растений, добавленных в Красный список в этом обновлении, а также полная переоценка всех африканских приматов имеют важное значение для активизации природоохранных мероприятий. Кроме того, эта информация будет важна для информационного обеспечения Рамочной программы по сохранению биоразнообразия на период после 2020 года, определяя прогресс в достижении Целей устойчивого развития », - сказал Масако Ямато, генеральный менеджер отдела по вопросам окружающей среды Toyota Motor Corporation .

    Для получения дополнительной информации или интервью обращайтесь:

    Харриет Брукер, МСОП по связям со СМИ, +44 7960241862, пресс @ iucn.org
    Маттиас Фихтер, МСОП по связям со СМИ, +41 795360117, [email protected]

    ###

    Заметки редактора

    Красный список МСОП: Красный список угрожаемых видов МСОП ™ способствует достижению цели 12 Стратегического плана в области сохранения и устойчивого использования биоразнообразия на 2011–2020 годы. Целевая задача 12. К 2020 году предотвращено исчезновение известных угрожаемых видов, а их природоохранный статус, особенно тех, которые находятся в наиболее упадке, улучшен и поддерживается.

    Партнерство МСОП-Тойота: Пятилетнее партнерство между МСОП и Toyota Motor Corporation, объявленное в мае 2016 г., значительно расширило знания о риске исчезновения более 28 000 видов, в том числе многих, которые являются ключевыми источниками пищи для значительной части население мира.Это партнерство осуществляется в рамках программы Toyota Environmental Challenge 2050, которая направлена ​​на снижение негативного воздействия, связанного с автомобилями, до нуля, одновременно оказывая положительное влияние на общество.

    Цитаты партнеров из Красного списка

    «Уменьшение численности лемуров Мадагаскара напрямую связано с утратой среды обитания и разнообразия местных растений. Недавняя работа в красном списке, проведенная Global Trees Assessment, показывает, что засушливые леса Мадагаскара являются домом для 982 видов деревьев, 90% из которых демонстрируют тенденции к сокращению численности населения, а 59% из них находятся под угрозой исчезновения.Эти виды деревьев необходимы не только для дикой природы, они также служат источником пищи, лекарств, укрытия и топлива для местных сообществ », - сказал Пол Смит, генеральный секретарь BGCI .

    «В этот выпуск включены оценки с другого мегапространственного острова, Новой Гвинеи. Некоторые из тех же процессов угрожают местообитаниям лемуров на Мадагаскаре: преобразование земель в сельскохозяйственные угодья, увеличение числа пожаров и вырубка леса - все это движущие силы исчезновения лесных видов на другом конце света », - сказала Хелен Чадберн, эксперт по сохранению видов Королевского королевского общества. Ботанический сад, Кью Schefflera из лесов Новой Гвинеи, родственники известного домашнего зонтичного растения, были оценены на предмет риска исчезновения. В Новой Гвинее эти виды могут составлять важные компоненты леса, и треть этих знаковых растений находится под угрозой или близкой к угрозе исчезновения ».

    «Сегодняшнее обновление Красного списка МСОП демонстрирует важность защиты разнообразия жизни на планете, особенно таких групп, как лемуры, которые чрезвычайно ограничены географически, что делает эти виды менее устойчивыми к разрушению среды обитания», - сказал Шон Т.О’Брайен, президент и главный исполнительный директор NatureServe . «Мы должны защитить уникальное биоразнообразие нашей планеты и должны искать возможности для использования данных, науки и технологий, чтобы предотвратить массовое вымирание, происходящее во всем мире».

    «Какое удивительное глобальное достижение - оценка более 120 000 видов, включая многие менее известные и упускаемые из виду виды, которые обеспечивают жизненно важные экосистемные услуги, лежащие в основе благополучия человека. Красный список МСОП, хотя и оценивает лишь часть видов, составляющих наш естественный мир, действует как барометр жизни на Земле.Мы должны прислушаться к его предупреждениям и предпринять смелые шаги, необходимые для создания будущего, в котором дикая природа и человечество процветают », - сказал д-р Эндрю Терри, директор по охране природы, ZSL .

    Глобальные данные по Красному списку находящихся под угрозой исчезновения МСОП 2020-2 гг .:
    • ВСЕГО ОЦЕНЕННЫХ ВИДОВ = 120 372
    • (Общее количество исчезающих видов = 32 441)
    • вымерших = 882
    • Вымершие в дикой природе = 77
    • Находящиеся под угрозой исчезновения = 6,811
    • Находящиеся под угрозой исчезновения = 11732
    • Уязвимые = 13 898
    • Находящиеся под угрозой = 7 211
    • Низкий риск / зависит от сохранения = 189 (это старая категория, которая постепенно выводится из Красного списка МСОП)
    • наименьшее беспокойство = 62 033
    • Дефицит данных = 17,539

    Цифры, представленные выше, относятся только к тем видам, которые на сегодняшний день были включены в Красный список МСОП.Хотя не все виды в мире были оценены, Красный список МСОП дает полезную картину того, что происходит с видами сегодня, и подчеркивает острую необходимость в действиях по сохранению. Относительные проценты для исчезающих видов не могут быть предоставлены для многих таксономических групп, включенных в Красный список МСОП, поскольку они не прошли всесторонней оценки. Для многих из этих групп усилия по оценке были сосредоточены на исчезающих видах; следовательно, процент исчезающих видов для этих групп будет сильно смещен.

    Для тех групп, которые прошли всестороннюю оценку, можно рассчитать процент угрожаемых видов, но фактическое количество угрожаемых видов часто бывает неопределенным, поскольку неизвестно, действительно ли виды с дефицитом данных (DD) находятся под угрозой исчезновения. Следовательно, представленные выше процентные значения обеспечивают наилучшую оценку риска исчезновения для тех групп, которые были всесторонне оценены (за исключением вымерших видов), исходя из предположения, что виды с дефицитом данных находятся под угрозой исчезновения, как и виды с достаточным объемом данных.Другими словами, это средний показатель в диапазоне от x% видов, находящихся под угрозой (если все виды DD не находятся под угрозой), до y% видов, находящихся под угрозой (если все виды DD находятся под угрозой). Имеющиеся данные показывают, что это наилучшая оценка.

    Категории угроз Красного списка МСОП следующие, в порядке убывания угроз:

    • Вымершие или исчезнувшие в дикой природе
    • Находящиеся под угрозой исчезновения, находящиеся под угрозой исчезновения и уязвимые: видов находятся под угрозой глобального исчезновения.
    • Находящиеся под угрозой исчезновения: видов, близких к пороговым значениям, находящимся под угрозой исчезновения, или которые могут оказаться под угрозой без текущих мер по сохранению.
    • Наименее опасные: видов оцениваются с меньшим риском исчезновения.
    • Недостаточно данных: Нет оценки из-за недостатка данных.
    • Критически находящиеся под угрозой исчезновения (возможно исчезнувшие) или находящиеся в критическом состоянии (возможно исчезнувшие в дикой природе): это не новые категории Красного списка МСОП, а флаги, разработанные для идентификации тех видов, находящихся под угрозой исчезновения, которые, по всей вероятности, уже вымерли, но для какое подтверждение требуется; например, из-за того, что были проведены более обширные исследования и не удалось найти каких-либо лиц

    Влияние трансфекции малой интерферирующей РНК на экспрессию мРНК FAK и DLC1 в OVCAR-3

  • 1.

    Маркман М. (2008) Фармацевтическое лечение рака яичников: текущее состояние. Наркотики 68: 771–789

    PubMed Статья CAS Google Scholar

  • 2.

    Джемал А., Брей Ф., Центр М.М., Ферлей Дж., Уорд Э., Форман Д. (2011) Глобальная статистика рака. CA Cancer J Clin 61: 69–90

    PubMed Статья Google Scholar

  • 3.

    Agarwal R, Kaye SB (2003) Рак яичников: стратегии преодоления устойчивости к химиотерапии.Nat Rev Cancer 3 (7): 502

    PubMed Статья CAS Google Scholar

  • 4.

    Видал Л., Аттард Дж., Кайе С., Де Боно Дж. (2004) Изменение устойчивости к таргетной терапии. J Chemother 16 (Дополнение 4): 7–12

    PubMed CAS Google Scholar

  • 5.

    Ричардсон А., Кей С.Б. (2005) Устойчивость к лекарствам при раке яичников: возрастающая важность транскрипции генов и пространственно-временной регуляции устойчивости.Обновление Drug Resist 8 (5): 311–321

    PubMed Статья CAS Google Scholar

  • 6.

    Ахтар С., Бентер И.Ф. (2007) Невирусная доставка синтетических миРНК in vivo. J Clin Invest 117: 3623–3632

    PubMed Статья CAS Google Scholar

  • 7.

    Aagaard L, Rossi JJ (2007) RNAi-терапия: принципы, перспективы и проблемы. Adv Drug Deliv Rev 59: 75–86

    PubMed Статья CAS Google Scholar

  • 8.

    Shim MS, Kwon YJ (2010) Эффективная и адресная доставка миРНК in vivo. FEBS J 277: 4814–4827

    PubMed Статья CAS Google Scholar

  • 9.

    Sanger F, Nicklen S, Coulson AR (1977) Секвенирование ДНК с помощью ингибиторов обрыва цепи. Proc Natl Acad Sci USA 74 (12): 5463–5467

    PubMed Статья CAS Google Scholar

  • 10.

    Hanahan D (1983) Исследования трансформации Escherichia coli плазмидами.J Mol Biol 166: 557–580

    PubMed Статья CAS Google Scholar

  • 11.

    Cannistra SA (2004) Рак яичника. N Engl J Med 351: 2519–2529

    PubMed Статья CAS Google Scholar

  • 12.

    Zhou X, Thorgeirsson SS, Popescu NC (2004) Восстановление экспрессии гена DLC-1 индуцирует апоптоз и ингибирует как рост клеток, так и онкогенность в клетках гепатоцеллюлярной карциномы человека.Онкоген 23 (6): 1308–1313

    PubMed Статья CAS Google Scholar

  • 13.

    Durkin ME, Yuan BZ, Zhou X, Zimonjic DB, Lowy DR, Thorgeirsson SS, Popescu NC (2007) DLC-1: белок, активирующий ГТФазу Rho, и опухолевый супрессор. J Cell Mol Med 11 (5): 1185–1207

    PubMed Статья CAS Google Scholar

  • 14.

    Kim TY, Lee JW, Kim HP, Jong HS, Kim TY, Jung M, Bang YJ (2007) DLC-1, белок, активирующий GTPase для Rho, связан с пролиферацией клеток, морфологией и миграция при гепатоцеллюлярной карциноме человека.Biochem Biophys Res Commun 355 (1): 72–77

    PubMed Статья CAS Google Scholar

  • 15.

    Holeiter G, Heering J, Erlmann P, Schmid S, Jahne R, Olayioye MA (2008), удаленный при раке печени 1, контролирует миграцию клеток через Dia1-зависимый сигнальный путь. Cancer Res 68: 8743–8751

    PubMed Статья CAS Google Scholar

  • 16.

    Syed V, Mukherjee K, Lyons-Weiler J, Lau KM, Mashima T, Tsuruo T, Ho SM (2005) Идентификация ATF-3, caveolin-1, DLC-1 и NM23-h3 как предполагаемые противоопухолевые, регулируемые прогестероном гены для раковых клеток яичников путем определения профиля генов.Онкоген 24: 1774–1787

    PubMed Статья CAS Google Scholar

  • 17.

    Feng MH, Huang B, Du ZG, Xu XP, Chen Z (2011) DLC-1 как модулятор пролиферации, апоптоза и миграции в клетках лимфомы Беркитта. Mol Biol Rep 38: 1915–1920

    PubMed Статья CAS Google Scholar

  • 18.

    Baik SH, Jee BK, Choi JS, Yoon HK, Lee KH, Kim YH, Lim Y (2009) ДНК-профилирование методом сравнительной геномной гибридизации массива (CGH) мононуклеарных клеток периферической крови (PBMC) и опухолевой ткани клетка в немелкоклеточном раке легкого (НМРЛ).Mol Biol Rep 36: 1767–1778

    PubMed Статья CAS Google Scholar

  • 19.

    Sieg DJ, Hauck CR, Ilic D, Klingbeil CK, Schaefer E, Damsky CH, Schlaepfer DD (2000) FAK объединяет сигналы фактора роста и интегрина, чтобы способствовать миграции клеток. Nat Cell Biol 2: 249–256

    PubMed Статья CAS Google Scholar

  • 20.

    Volberg T, Romer L, Zamir E, Geiger B (2001) pp 60 (c-src) и родственные тирозинкиназы: роль в сборке и реорганизации матричных адгезий.J Cell Sci 114: 2279–2289

    PubMed CAS Google Scholar

  • 21.

    Zhao JH, Reiske H, Guan JL (1998) Регулирование клеточного цикла с помощью киназы фокальной адгезии. J Cell Biol 143: 1997–2008

    PubMed Статья CAS Google Scholar

  • 22.

    McLean GW, Komiyama NH, Serrels B, Asano H, Reynolds L, Conti F, Hodivala-Dilke K, Metzger D, Chambon P, Grant SG, Frame MC (2004) Подавляет специфическую делецию киназы фокальной адгезии образование опухоли и блокирует злокачественное прогрессирование.Genes Dev 18: 2998–3003

    PubMed Статья CAS Google Scholar

  • 23.

    Li N, Li Q, Zhou XD, Колосов В.П., Перельман JM (2012) Хронический механический стресс индуцирует экспрессию муцина 5AC в эпителиальных клетках бронхов человека через ERK-зависимые пути. Mol Biol Rep 39: 1019–1028

    PubMed Статья CAS Google Scholar

  • 24.

    He S, Zhang DC, Cheng F, Gong FH, Guo YN (2009) Применение РНК-интерференции в терапии рака как мощный инструмент для подавления экспрессии генов.Mol Biol Rep 36: 2153–2163

    PubMed Статья CAS Google Scholar

  • 25.

    Benlimame N, He Q, Jie S, Xiao D, Xu YJ, Loignon M, Schlaepfer DD, Alaoui-Jamali MA (2005) Передача сигналов FAK имеет решающее значение для взаимодействия рецепторов ErbB-2 / ErbB-3 в отношении онкогенных заболеваний. трансформация и вторжение. J Cell Biol 171: 505–516

    PubMed Статья CAS Google Scholar

  • 26.

    Mitra SK, Lim ST, Chi A, Schlaepfer DD (2006) Внутренняя фокальная активность киназы адгезии контролирует метастазирование ортотопической карциномы молочной железы посредством регуляции экспрессии активатора плазминогена урокиназы в модели сингенной опухоли. Онкоген 25: 4429–4440

    PubMed Статья CAS Google Scholar

  • 27.

    Van Nimwegen MJ, Verkoeijen S, Van Buren L, Burg D, Van de Water B (2005) Потребность в киназе фокальной адгезии на ранней стадии формирования метастазов легочной аденокарциномы молочной железы.Cancer Res 65: 4698–4706

    PubMed Статья Google Scholar

  • 28.

    Schaller MD (2001) Биохимические сигналы и биологические ответы, вызванные киназой фокальной адгезии. Biochim Biophys Acta 1540: 1-21

    PubMed Статья CAS Google Scholar

  • 29.

    Schlaepfer DD, Hauck CR, Sieg DJ (1999) Передача сигналов через киназу фокальной адгезии. Prog Biophys Mol Biol 71: 435–478

    PubMed Статья CAS Google Scholar

  • 30.

    Zhao J, Zheng C, Guan J (2000) Pyk2 и FAK по-разному регулируют развитие клеточного цикла. J Cell Sci 113: 3063–3072

    PubMed CAS Google Scholar

  • 31.

    Reif S, Lang A, Lindquist JN, Yata Y, Gabele E, Scanga A, Brenner DA, Rippe RA (2003) Роль передачи сигналов фокальной адгезионной киназы-фосфатидилинозитол-3-киназы-akt в звездчатых клетках печени пролиферация и экспрессия коллагена типа I. J Biol Chem 278: 8083–8090

    PubMed Статья CAS Google Scholar

  • 32.

    Horowitz JC, Rogers DS, Sharma V, Vittal R, White ES, Cui Z, Thannickal VJ (2007) Комбинаторная активация FAK и AKT путем трансформации фактора роста-β1 придает миофибробластам фенотип, устойчивый к аноикису. Cell Signal 19: 761–771

    PubMed Статья CAS Google Scholar

  • 33.

    Bouchard V, Demers MJ, Thibodeau S, Laquerre V, Fujita N, Tsuruo T, Beaulieu JF, Gauthier R, Vezina A, Villeneuve L, Vachon PH (2007) Передача сигналов Fak / Src в эпителиальных клетках кишечника человека выживание и аноикис: специфическое для состояния дифференциации разобщение с путями PI3-K / Akt-1 и MEK / Erk.J Cell Physiol 212: 717–728

    PubMed Статья CAS Google Scholar

  • 34.

    Диллон Р.Л., Уайт Д.Е., Мюллер В.Дж. (2007) Сигнальная сеть фосфатидилинозитол-3-киназы: последствия для рака груди человека. Онкоген 26: 1338–1345

    PubMed Статья CAS Google Scholar

  • 35.

    Orsulic S, Li Y, Soslow RA, Vitale-Cross LA, Gutkind JS, Varmus HE (2002) Индукция рака яичников посредством определенных множественных генетических изменений в модельной системе мышей.Cancer Cell 1: 53–62

    PubMed Статья CAS Google Scholar

  • 36.

    Nicholson DW, Ali A, Thornberry NA, Vaillancourt JP, Ding CK, Gallant M, Gareau Y, Griffin PR, Labelle M, Lazebnik YA (1995) Необходимы идентификация и ингибирование протеазы ICE / CED-3 для апоптоза млекопитающих. Nature 376: 37–43

    PubMed Статья CAS Google Scholar

  • 37.

    Fernandes-Alnemri T, Litwack G, Alnemri ES (1994) CPP32, новый апоптотический белок человека с гомологией с белком гибели клеток Caenorhabditis elegans Ced-3 и бета-превращающим ферментом интерлейкин-1 млекопитающих. J Biol Chem 269: 30761–30764

    PubMed CAS Google Scholar

  • 38.

    Tormanen-Napankangas U, Soini Y, Kahlos K, Kinnula V, Paakko P (2001) Экспрессия каспаз-3, -6 и -8 и их связь с апоптозом при немелкоклеточной карциноме легкого.Int J Cancer 93: 192–198

    PubMed Статья CAS Google Scholar

  • 39.

    Hsia JY, Chen CY, Chen JT, Hsu CP, Shai SE, Yang SS, Chuang CY, Wang PY, Miaw J (2003) Прогностическое значение экспрессии каспазы-3 при первичной резекции плоскоклеточной карциномы пищевода. Eur J Surg Oncol 29: 44–48

    PubMed Статья Google Scholar

  • 40.

    Kania J, Konturek SJ, Marlicz K, Hahn EG, Konturek PC (2003) Экспрессия выживания и каспазы-3 при раке желудка.Dig Dis Sci 48: 266–271

    PubMed Статья CAS Google Scholar

  • 41.

    Дегтерев А., Юань Дж. (2008) Расширение и развитие программ клеточной смерти. Nat Rev Mol Cell Biol 9 (5): 378–390

    PubMed Статья CAS Google Scholar

  • 42.

    Srinivasula SM, Ahmad M, Fernandes-Alnemri T, Alnemri ES (1998) Автоактивация прокаспазы-9 посредством олигомеризации, опосредованной Apaf-1.Mol Cell 1: 949–957

    PubMed Статья CAS Google Scholar

  • 43.

    Auersperg N, Wong AS, Choi KC, Kang SK, Leung PC (2001) Поверхностный эпителий яичников: биология, эндокринология и патология. Endocr Ред. 22: 255–288

    PubMed Статья CAS Google Scholar

  • 44.

    Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ (2009) Статистика рака, 2009.CA Cancer J Clin 59: 225–249

    PubMed Статья Google Scholar

  • (PDF) Биомедицинская оценка сифаки Верро (Propithecus Verreauxi) из национального парка Киринди Митеа на Мадагаскаре

    23. Junge RE, Louis EE. Биомедицинская оценка

    черных лемуров (Eulemur macaco macaco) в заповеднике Локобе

    , Мадагаскар. J Zoo Wildl Med. 2007; 38: 67–

    76.

    24. Каур Т., Сингх Дж., Тонг С., Хамфри С., Клевенджер

    Д., Тан В., Секели Б., Ван И, Ли И, Алекс Мьюз Э,

    Кийоно М., Ханамура С., Иноуэ Е., Накамура М.,

    Хаффман М.А., Цзян Б. и Нишида Т.Описательная

    эпидемиология смертельных респираторных вспышек и обнаружение связанного с человеком метапневмовируса у диких

    шимпанзе (Pan troglodytes) в Национальном парке гор Махале

    , Западная Танзания. Am J Primatol.

    2008; 70: 755–765.

    25. Ким С.Й., Хан Дж. С., Сузуки Т., Хан СС. Косвенный

    индикатор транспортного стресса в гематологических значениях

    недавно приобретенных обезьян яванского макака. J Med Primatol.

    2005; 34: 188–192.

    26. Кок Р.А., Михок С.Р., Вамбуа Дж., Мванзия Дж.,

    Сайгава К. Влияние транслокации на гематологические параметры

    свободно обитающего черного носорога (Diceros

    bicornis michaeli) в Кении. J Zoo Wildl Med.

    1999; 30: 389–396.

    27. Ковалевски М.М., Salzer JS, Deutsch JC, Rano

    M, Kuhlenschmidt MS, Gillespie TR. Черный и золотой

    обезьяны-ревуны (Alouatta caraya) как охранники здоровья экосистемы

    : закономерности заражения зоонозными простейшими -

    в зависимости от степени контакта человека с приматом.Am J

    Primatol. 2011; 73: 75–83.

    28. Лейтон Ф.А. Оценка риска для здоровья при перемещении диких животных

    . Rev Sci Tech.

    2002; 21: 187–195.

    29. Льюис Р.Дж., Баннар-Мартин К.Х. Воздействие циклона

    Cyclone Fanele на сухой тропический лес на Мадагаскаре.

    Biotropica. 2012; 44: 135–140.

    30. Лилли А.А., Мельман П.Т., Доран Д. Кишечные паразиты

    у горилл, шимпанзе и людей в Исследовательском центре Мон-

    Дика, Национальный парк Дзанга-Ндоки, Цен-

    трала Африканская Республика.Int J Primatol. 2002. 23: 555–573.

    31. Лайлс А.М., Добсон А.П. Инфекционное заболевание и интенсивное лечение

    - динамика популяции, угроза-

    зараженных хозяев и их паразиты. J Zoo Wildl Med.

    1993; 24: 315–326.

    32. Мэр Мичиган, Соммер Дж. А., Хоук М.Л., Заонарив -

    lo JR, Райт П.С., Инграм С., Энгель С.Р., Луис Э.

    Конкретный статус Propithecus spp. Int J Primatol.

    2004; 25: 875–900.

    33. МакКаллум Х., Добсон А.Выявление

    угроз болезней и паразитов исчезающим видам и экосистемам.

    Trends Ecol Evol. 1995; 10: 190–194.

    34. Муленбейн М.П., ​​Шварц М., Ричард А.

    Паразитологический анализ сифаки (Propithecus ver-

    reauxi) в Беза Махафали, Мадагаскар. J Zoo Wildl

    Med. 2003. 34: 274–277.

    35. Низей Дж. Б., Мвебе Р., Нантеза А., Кранфилд М.Р.,

    Калема Г.Р., Грачик Т.К. Cryptosporidium sp. и

    Giardia sp.инфекции у горных горилл (Gorilla

    gorilla beringei) в Национальном парке Бвинди

    , Уганда. J Parasitol. 1999; 85: 1084–1088.

    36. Obernier JA, Baldwin RL. Установление соответствующего периода акклиматизации

    после перевозки лабораторных животных

    . ILAR J. 2006; 47: 364–

    369.

    37. Rasambainarivo F, Gillespie T, Wright P, Arsen-

    ault J, Villeneuve A, Lair S. Survey of Giardia и

    Cryptosporidium у лемуров из Ranomafana Na-

    национальный парк, Мадагаскар.J Wildl Dis. 2013; 49: 741–743.

    38. Rasambainarivo FT, Junge RE. 12-месячный обзор

    желудочно-кишечных гельминтозов лемуров

    , проводимых в двух зоопарках на Мадагаскаре. J Zoo Wildl Med.

    2010; 41: 638–642.

    39. Ричард А.Ф. Вариации поведения: пример малагасийского лемура

    . Льюисбург (Пенсильвания): Bucknell Univ. Нажмите;

    1978. 211 стр.

    40. Ричард А.Ф., Николл М.Э. Социальное доминирование самок

    Финансирование и основной обмен у малагасийских приматов,

    Propithecus verreauxi.Am J Primatol. 1987. 12: 309–314.

    41. Ричард А.Ф., Ракотоманга П., Шварц М.

    Демография Propithecus verreauxi в Беза Махафали,

    Мадагаскар: соотношение полов, выживаемость и плодовитость, 1984–

    1988. Am J Phys Anthropol. 1991; 84: 307–322.

    42. Ричард А.Ф., Ракотоманга П., Шварц М.

    Распространение Propithecus verreauxi в Беза Махафали,

    Мадагаскар: 1984–1991. Am J Primatol. 1993; 30: 1–20.

    43. Roelke-Parker ME, Munson L, Packer C, Kock

    R, Cleaveland S, Carpenter M, O'Brien SJ, Pospischil

    A, Hofmann-Lehmann R, Lutz H, Mwamengele GL,

    Mgasa MN, Machange GA, Summers BA, Appel MJ.

    Эпидемия вируса чумы собак у львов Серенгети

    (Panthera leo). Природа. 1996; 379: 441–445.

    44. Salzer JS, Rwego IB, Goldberg TL, Kuhlen-

    Schmidt NS, Gillespie TR. Giardia sp. и Cryptospo-

    ridium sp. инфекции у приматов во фрагментированных и

    нетронутых лесах на западе Уганды. J Parasitol.

    2007; 93: 439–440.

    45. Слиман Дж. М., Мейдер Л.Л., Мудакиква А.Б.,

    Фостер Дж. У., Паттон С. Желудочно-кишечные паразиты

    горных горилл (Gorilla gorilla beringei) в парке

    Национальных вулканов, Руанда.J Zoo Wildl Med.

    2000; 31: 322–328.

    46. Спенсер Дж. А., Столяр К. С., Хилтон К. Д., Дубей Дж. П.,

    Тойвио-Киннукан М., Минк Дж. К., Блэгберн Б.Л. Dissem-

    зараженный токсоплазмоз у кольчатого лемура в неволе

    (Lemur catta). J Parasitol. 2004; 90: 904–906.

    47. Wasfy M, Oyofo B, Elgindy A, Churilla A.

    Сравнение консервационных сред для хранения стула

    образцов. J Clin Microbiol. 1995; 33: 2176–2178.

    48. Wobeser, G.Стратегии борьбы с болезнями

    диких животных. Rev Sci Tech. 2002; 21: 159–178.

    49. Ян Л., Грей В. Референтные интервалы для педиатрии для маркеров кости

    . Clin Biochem. 2006. 39: 561–568.

    Получено для публикации 7 марта 2013 г.

    RASAMBAINARIVO et al. - БИОМЕДИЦИНСКАЯ ОЦЕНКА SIFAKA Веррео 255

    MOB2 подавляет миграцию и инвазию клеток GBM посредством регулирования передачи сигналов FAK / Akt и cAMP / PKA

    Культура клеток и трансфекция

    Человек Клеточные линии GBM LN-229, T98G, LN-18, U87MG, глиома Hs683 низкой степени злокачественности, клеточная линия микроглии человека HMC3 и клеточные линии 293T почки эмбриона человека были получены из Американской коллекции типовых культур, клеточные линии GBM человека SF-539 и SF- 767 были получены из банка клеток Китайской академии наук.Клеточная линия НА астроцитов человека была получена от ScienCell. Смешанные глиальные клетки выделяли в течение 24 часов из церебральных щенков крыс Sprague-Dawley (SD), первичные клетки (10 7 клеток / 75 см 2 ) высевали на покрытые полилизином 75-см колбы 2 , снабженные DMEM среда, содержащая 10% FBS, добавляя половину объема DMEM каждые 2–3 дня. Через восемь дней супернатант (первичная микроглия крысы) и прилипшие клетки собирали методом встряхивания. К прикрепленным клеткам добавляли гидрохлорид метилового эфира 1-лейцина в течение 1 ч и промывали один раз PBS, затем добавляли среду DMEM с 10% FBS для использования (первичные астроциты крысы).Клетки T98G, U87MG и HMC3 обычно поддерживали в среде MEM с 10% FBS. LN-229 и другие клетки культивировали в среде DMEM с 5 и 10% FBS соответственно. Все клетки поддерживали при 37 ° C в увлажненном инкубаторе с 5% CO 2 . Все клетки были проверены на заражение микоплазмами. Малые интерферирующие РНК (siFAK: для FAK использовали два олигонуклеотида siRNA: 5'-GCGAUUAUAUGUUAGAGAU-3 'и 5'-GUAUUGGACCUGCGAGGGA-3') или отрицательный контроль (siCON) были приобретены у Genepharma (Шанхай, Китай). Lipofectamine 3000 (Invitrogen, Carlsbad, America) в соответствии с инструкциями производителя.

    Антитела и реагенты

    Следующие антитела были приобретены у Cell Signaling Technology (Америка): MOB1 (3863S), FAK (3285S), p-FAK (8556S), Akt (9272S), p-Akt (9271S), p. -Паксиллин (2541S), CREB (9197S), V5-tag (13,202S). Анти-MOB2 (PA5-75591) и анти-V5 (66004-1) были получены от Invitrogen Thermo Fisher Scientific (Америка, Калифорния). GAPDH (10494-1-AP) и GFP-tag (50430-2-AP) были закуплены у Proteintech (Америка). Паксиллин (05-417) и p-CREB (06-519) были получены от EMD Millipore (Америка).Ki67 был получен от Servicebio (GB13030-2). AZD9291 (S7297), C188-9 (S8605), Cyclo-RGDfK (C-RGD, S7834), H89 (S1582), LY364947 (S2805), MK2206 (S1078), PD98059 (S1177), PF562271 (S2890), SC79 ( S7863) и SQ22536 (S8283) были приобретены у Selleck Chemicals (Америка). BAY-11-7086 был получен от Medchemexpress (Америка). Форсколин (F6886) был приобретен у Sigma (Америка). Все препараты растворяли в диметилсульфоксиде и хранили при -20 ° C.

    Плазмиды и лентивирус

    Экспрессионные плазмиды MOB2-WT с меткой V5 (дикий тип) и MOB2-h257A с меткой V5 были любезно предоставлены проф.Хергович (Институт рака UCL, Университетский колледж Лондона, Великобритания). GFP tagged-PKA был любезно предоставлен профессором Юфэй Гуан (Даляньский медицинский университет, Китай). Чтобы стабильно экспрессировать MOB2 в клетках SF-539 и SF-767, V5-MOB2 клонировали в pCDH-puro лентивирусный вектор с помощью ПЦР, и полученная плазмида была названа pCDH-MOB2. Лентивирусные векторы, кодирующие короткие шпильчатые РНК (GIPZ-shRNA), нацеленные на MOB2, и скремблированную shRNA были приобретены у Dharmacon (Америка).

    Иммуноблоттинг и иммунопреципитация

    Иммунопреципитация (IP) и иммуноблоттинг (IB) были выполнены, как описано ранее 43 .Для эндогенных взаимодействий собирали клетки LN-229 и T98G, выращенные в чашках размером 10 см, 90 · 10 5 2, 90 · 106, и лизаты клеток затем подвергали IP.

    Иммунофлуоресценция

    Клетки глиомы высевали на покровные стекла (NEST, 801008) на 24 часа. Клетки фиксировали в 4% параформальдегиде (PFA) и подвергали проницаемости в 0,2% Triton X-100. После блокирования в 3% бычьем сывороточном альбумине (BSA) клетки затем инкубировали с первичным антителом в течение 2 часов при комнатной температуре с последующей 30-минутной инкубацией с соответствующими вторичными антителами, конъюгированными с родамином, при комнатной температуре.Ядра окрашивали 5 мкг / мл DAPI (Sigma) в PBS. Для контроля иммунофлуоресценции (IF) применяли лазерный сканирующий конфокальный микроскоп (Leica TCS SP5 ×).

    Иммуногистохимия

    Срезы ткани, залитые парафином, толщиной четыре миллиметра депарафинизировали с использованием серии убывающих ксилол / спирт. Вкратце, обработанные срезы блокировали 3% BSA и инкубировали с антителами против MOB2 или Ki67 (1:50). Набор для обнаружения DAB использовали для выработки сигнала окрашивания в соответствии с протоколами, предусмотренными для системы стрептавидин-пероксидаза. (Сангон Биотех, Китай).Гематоксилин использовали для контрастного окрашивания. Все срезы исследованы с помощью световой микроскопии.

    ПЦР в реальном времени

    РНК экстрагировали тризолом и подвергали обратной транскрипции с помощью набора FastKing RT (Tiangen Biotech, Китай) в соответствии с инструкциями. ОТ-ПЦР выполняли с использованием Invitrogen 2 × SYBR Realtime Mix и MxPro System. Значения флуоресценции каждой группы рассчитывали согласно ∆∆Ct. Праймеры ANXA8, CD24, CXCL8, IL6, L1CAM, MMP1, MMP3 и SOX9, используемые для ПЦР в реальном времени, представлены в дополнительной таблице 3.

    Transwell миграции и анализы инвазии

    Эксперименты по миграции и инвазии в этой статье проводились с поликарбонатной мембраной диаметром 6,5 мм и размером пор 8,0 мкм, которая была предварительно покрыта (для анализа инвазии) или без (для анализа миграции) 50 мкл матригеля. Клетки предварительно обрабатывали митомицином C (S8146, Selleck, America), а затем клетки, ресуспендированные в 200 мкл бессывороточной среды, высевали в верхнюю камеру и добавляли в общей сложности 650 мкл полной среды с добавлением 10% FBS. в нижнюю камеру.После инкубации при 37 ° C с 5% CO 2 клетки, прошедшие через мембрану, фиксировали 4% формальдегидом в течение 30 минут и окрашивали 0,1% кристаллическим фиолетовым в течение 20 минут. После удаления верхнего слоя немигрированных или неинвазивных клеток ватным тампоном клетки подсчитывали с помощью световой микроскопии.

    Анализ Аноикиса

    Клетки глиомы высевали на планшеты, покрытые поли-HEMA. Клетки собирали осторожным пипетированием через 72 часа и повторно помещали на обычные чашки для культивирования на 48 часов.Клетки обрабатывали трипсином для ручного подсчета.

    Анализ образования колоний

    Суспензию клеток глиомы высевали в 6-луночные планшеты и культивировали в полной среде с добавлением 10% FBS в течение 14 дней. Количество колоний (содержащих 50 или более клеток) подсчитывали под световым микроскопом.

    BrdU assay

    Клетки глиомы метили BrdU (GE Healthcare; RPN202), выполняли, как описано ранее 44 .

    Модель метастазирования куриного эмбриона

    Оплодотворенные куриные яйца, не содержащие специфических патогенов, были получены от Vital River Laboratory Animal Technology (Пекин, Китай).Яйца инкубировали при 37 ° C и влажности 35%. Через 10 дней яйца были случайным образом разделены на четыре группы ( n = 10) в соответствии с таблицей случайных чисел, а именно shCON, shMOB2, pCDH-VEC и pCDH-MOB2. эксперимент. 1 × 10 7 клеток глиомы инъецировали в хориоаллантоисную мембрану (CAM) и затем вылупляли в течение 8 дней, снимали изображения и измеряли размеры опухоли по следующей формуле: V = 4/3 × π × r 3 ( r = 1/2 × квадратный корень из диаметра 1 × диаметр 2).Опухоли удаляли и фиксировали в растворе Буэна (Solarbio, Пекин, Китай) для гистопатологического анализа с окрашиванием гематоксилин-эозином (HE) или иммуногистохимического анализа с использованием антитела против Ki67. Эксперименты с куриными эмбрионами проводились в Даляньском медицинском университете (Далянь, Китай) в соответствии с национальными рекомендациями по уходу и использованию лабораторных животных. Исследование на животных проводилось в строгом соответствии с протоколом, утвержденным комитетом по этике экспериментальных животных Даляньского медицинского университета.

    Эксперимент по ксенотрансплантату опухоли in vivo

    Клетки глиомы (1 × 10 7 ) вводили подкожно в бока самкам голых мышей BALB / c (возраст 6 недель), которые содержались в учреждениях по уходу за животными без специфических патогенов. Мышей случайным образом разделили на две группы ( n = 4) в соответствии с таблицей случайных чисел, а именно pCDH-VEC и pCDH-MOB2, при этом исследователь не знал о распределении групп во время эксперимента. Рост опухоли контролировали с помощью штангенциркуля, где еженедельно измеряли два перпендикулярных диаметра опухоли и рассчитывали объем опухоли по формуле 0.5 × длина × ширина 2 . Через семь недель мышей с опухолями умерщвляли под эфирным наркозом и вырезали ксенотрансплантаты. Эксперименты на животных проводились в Даляньском медицинском университете (Далянь, Китай) в соответствии с национальными рекомендациями по уходу и использованию лабораторных животных. Исследование на животных проводилось в строгом соответствии с протоколом, утвержденным комитетом по этике экспериментальных животных Даляньского медицинского университета.

    Образцы человека

    Это исследование было проведено с одобрения Комитета по этике Даляньского медицинского университета.Письменное информированное согласие было получено от всех пациентов, и данные были проанализированы анонимно. Залитые в парафин, гистопатологически и клинически диагностированные образцы глиомы (степень II – IV, n = 35) и образцы нормальной ткани ( n = 8) были собраны во второй больнице, являющейся филиалом Даляньского медицинского университета. Уровни экспрессии белка MOB2 в 35 залитых парафином тканях глиомы и восьми нормальных тканях были исследованы с помощью ИГХ. Оценка окрашивания ИГХ основывалась на интенсивности окрашивания.Баллы 0–4 использовались для классификации процента положительных опухолевых клеток (0% = 0, 1–25% = 1, 26–50% = 2, 51–75% = 3 и 76–100% = 4) и интенсивность окрашивания мембраны (отрицательное = 0, слабое = 1, среднее = 2 или сильное = 3). Эти две оценки впоследствии были умножены. Низкая экспрессия определялась как имеющая окончательные баллы ≤6, а высокая экспрессия определялась как конечные баллы> 6. Еще 13 замороженных тканей глиомы были собраны в онкологической больнице Ляонин Китайского медицинского университета, уровни экспрессии белка MOB2 были проверены IB, а GAPDH использовался в качестве контроля нагрузки.

    Биоинформатический анализ

    РНК была экстрагирована из клеток shControl и shMOB2 LN-229, а RNA-Seq была выполнена корпорацией Novogen Corporation (Пекин, Китай). Библиотеки секвенирования были созданы с использованием набора NEBNext® UltraTM RNA Library Prep Kit для Illumina® (NEB, США) в соответствии с инструкциями производителя. Чистые данные были получены путем удаления чтения, содержащего адаптер, чтения, содержащего ploy-N, и чтения низкого качества из необработанных данных fastq с использованием собственных сценариев Perl. Чистые чтения с парных концов выравнивали с эталонным геномом hg38 с использованием Hisat2 v2.0,5. featureCounts v1.5.0-p3 использовался для создания матрицы подсчета на уровне генов в качестве входных данных для статистической модели edgeR. Анализ дифференциальной экспрессии между клетками shMOB2 и shControl проводили с использованием пакета edgeR. Значения p были скорректированы с использованием метода Benjamini & Hochberg. Скорректированное значение p , равное 0,05, и абсолютное кратное изменение, равное 2, были установлены в качестве порогового значения для значимой дифференциальной экспрессии. Данные РНК-seq депонированы в NCBI Gene Expression Omnibus под номером доступа GSE139339.Чтобы изучить паттерн экспрессии и прогностические последствия MOB2 в глиомах, предварительно обработанные последовательности РНК и клинические данные были загружены из UCSC XENA (TCGA-GBMLGG) (https://xenabrowser.net/datapages/). Данные микромассивов были получены из репозитория Gene Expression Omnibus и ArrayExpress с регистрационным номером GSE4209 и E-GEOD-16011. Необработанные данные (.cel) обрабатывались с помощью функции rma из пакета rma Bioconductor с настройками по умолчанию. Функция mas5calls из пакета affy использовалась для генерации вызовов наличия / отсутствия / отсутствия для всех реплик образцов всех наборов зондов.Каждому «присутствующему» вызову было присвоено значение 1,0, «маргинальному» было присвоено значение 0,5, а «отсутствующему» - значение 0. Для средних значений> 0,4 ​​набор датчиков считался надежным обнаружением. Неспецифические наборы тестов, которые заканчивались на «_x_at», были исключены. Затем отфильтрованные наборы зондов были сопоставлены с соответствующими генами с помощью пакета аннотаций hgu133plus2.db. Множественные наборы зондов, сопоставленные с одним и тем же геном, были агрегированы как среднее значение интенсивности сигнала. Пациенты с глиомой подразделяются на группы с высокой и низкой экспрессией MOB2 с использованием 1-го квартиля в качестве точек отсечения (1-й квартиль vs.квартили 2–4) и кривые выживаемости были основаны на оценках Каплана – Мейера. Дифференциальную экспрессию MOB2 в образцах головного мозга GBM, LGG и нормального мозга определяли с помощью непараметрического критерия Манна – Уитни.

    Статистический анализ

    Сравнение данных сначала проводили с использованием одностороннего дисперсионного анализа (ANOVA). Множественные сравнения между группами лечения и контролями оценивали с использованием критерия наименьшего значимого различия Даннета (LSD). Для анализа данных in vivo статистическая значимость между группами рассчитывалась на основе теста LSD с использованием SPSS 17.0 (SPSS Inc., Чикаго, Иллинойс, США). Статистически значимым считалось значение p , равное p <0,05. Все эксперименты проводили в трех повторностях как три независимых эксперимента. Все статистические тесты обоснованы надлежащим образом, и данные соответствуют предположениям тестов. Различия между группами, которые сравниваются статистически, одинаковы.

    MCR-13-0505 514..526

    % PDF-1.5 % 113 0 объект > эндобдж 110 0 объект > поток 2014-04-01T08: 09: 37 + 05: 302021-05-16T20: 12: 14-07: 00Arbortext Advanced Print Publisher 9.1.406 / W Unicode2021-05-16T20: 12: 14-07: 00 Приложение Acrobat Distiller 9.4.0 (Macintosh) / pdf

  • MCR-13-0505 514..526
  • вершина
  • uuid: 127d1856-1dd2-11b2-0a00-9f09271d5700uuid: 127d1859-1dd2-11b2-0a00-bf0000000000 конечный поток эндобдж 111 0 объект > эндобдж 104 0 объект > эндобдж 106 0 объект > эндобдж 107 0 объект > эндобдж 108 0 объект > эндобдж 61 0 объект > / Font> / ProcSet [/ PDF / Text] >> / TrimBox [28.224 28.224 613.241 811.197] / Type / Page >> эндобдж 63 0 объект > / Font> / ProcSet [/ PDF / Text] >> / TrimBox [28.224 28.224 613.241 811.197] / Тип / Страница >> эндобдж 65 0 объект > / Font> / ProcSet [/ PDF / Text] >> / TrimBox [28.224 28.224 613.241 811.197] / Type / Page >> эндобдж 163 0 объект > / ProcSet [/ PDF / Text / ImageC] / XObject >>> / Type / Page >> эндобдж 174 0 объект [180 0 R 181 0 R 182 0 R 183 0 R 184 0 R 185 0 R 186 0 R 187 0 R] эндобдж 175 0 объект > поток q 538.6593933 0 0 80.8514099 51.1703033 710.1485901 см / Im0 Do Q BT / T1_0 1 Тс 10 0 0 10 104,45978 611,99985 тм (2014; 12: 514-526. Опубликовано в Интернете впервые 24 января 2014 г.)) Tj / T1_1 1 Тс -7,44598 0 Тд (Mol Cancer Res \ 240) Tj / T1_0 1 Тс 0 1 ТД (\ 240) Tj 0 1.00001 TD (Майкл Л. Мегисон, Лорен А. Гиллори, Джерри Э. Стюарт и др.) Tj / T1_2 1 Тс 0 1 ТД (\ 240) Tj / T1_3 1 Тс 18 0 0 18 30 651,99997 тм (Детские опухоли почек) Tj Т * (Ингибирование FAK отменяет злокачественный фенотип в агрессивном состоянии) Tj ET 30 524 581 68 рэ 0 0 мес. S BT / T1_0 1 Тс 11 0 0 11 120,94 202 564,99997 тм (\ 240) Tj / T1_3 1 Тс -7,55696 1 тд (Обновленная версия) Tj ET BT / T1_2 1 Тс 10 0 0 10 141 556,99994 тм (\ 240) Tj / T1_0 1 Тс 16.84196 1 тд () Tj 0 0 1 рг -15.22996 0 Тд (10.1158 / 1541-7786.MCR-13-0505) Tj 0 г -1,612 0 Тд (DOI 🙂 Tj 0 1.00001 TD (См. Самую последнюю версию этой статьи по адресу:) Tj ET BT / T1_0 1 Тс 11 0 0 11 120.94202 523.99994 тм (\ 240) Tj / T1_3 1 Тс -3,50099 1 тд (Материал) Tj -3,44499 1,00001 тд (Дополнительно) Tj ET BT / T1_2 1 Тс 10 0 0 10 141 526,99994 тм (\ 240) Tj / T1_0 1 Тс 37.01692 1 тд () Tj 0 0 1 рг -37.01692 0 Тд (http://mcr.aacrjournals.org/content/suppl/2014/01/24/1541-7786.MCR-13-05 \ 05.DC1) Tj 0 г Т * (Доступ к самым последним дополнительным материалам по адресу:) Tj ET BT / T1_2 1 Тс 10 0 0 10 30 503.99997 Тм (\ 240) Tj 0 1 ТД (\ 240) Tj ET BT / T1_2 1 Тс 10 0 0 10 30 483,99997 тм (\ 240) Tj Т * (\ 240) Tj ET 30 414 581 70 рэ 0 0 мес. S BT / T1_0 1 Тс 11 0 0 11 120,94 202 451,99997 тм (\ 240) Tj / T1_3 1 Тс -6.00198 1 тд (Цитированные статьи) Tj ET BT / T1_2 1 Тс 10 0 0 10 141 443,99994 тм (\ 240) Tj / T1_0 1 Тс 25.06593 1 тд () Tj 0 0 1 рг -25.06593 0 Тд (http://mcr.aacrjournals.org/content/12/4/514.full#ref-list-1)Tj 0 г 0 1.00001 TD (Эта статья цитирует 45 статей, 14 из которых вы можете получить бесплатно по адресу:) Tj ET BT / T1_0 1 Тс 11 0 0 11 120.94202 421,99997 тм (\ 240) Tj / T1_3 1 Тс -6,33498 1 тд (Цитирование статей) Tj ET BT / T1_2 1 Тс 10 0 0 10 141 413,99994 тм (\ 240) Tj / T1_0 1 Тс 26.45593 1 тд () Tj 0 0 1 рг -26.45593 0 Тд (http://mcr.aacrjournals.org/content/12/4/514.full#related-urls)Tj 0 г Т * (Эта статья процитирована в 3 статьях, размещенных на HighWire. Перейдите в ar \ ticles at:) Tj ET BT / T1_2 1 Тс 10 0 0 10 30 393,99997 тм (\ 240) Tj 0 1 ТД (\ 240) Tj ET 30 279 581 115 рэ 0 0 мес. S BT / T1_0 1 Тс 11 0 0 11 120,94 202 361,99997 тм (\ 240) Tj / T1_3 1 Тс -5.66901 1 тд (Оповещения по электронной почте) Tj ET BT / T1_0 1 Тс 10 0 0 10 295,49966 374 тм (относится к этой статье или журналу.) Tj 0 0 1 рг -15.44997 0 Тд (Зарегистрируйтесь, чтобы получать бесплатные уведомления по электронной почте) Tj ET BT 0 г / T1_0 1 Тс 11 0 0 11 120.94202 328.99994 тм (\ 240) Tj / T1_3 1 Тс -6.38997 1 тд (Подписки) Tj 0,556 1,00001 тд (Отпечатки и) Tj ET BT / T1_0 1 Тс 10 0 0 10 141 331,99994 тм (\ 240) Tj 6.85098 1 тд (.) Tj 0 0 1 рг -6.85098 0 Тд ([email protected]) Tj 0 г 0 1.00001 TD (Чтобы заказать перепечатку этой статьи или подписаться на журнал, свяжитесь с нами \ t Отдел публикаций AACR в) Tj ET BT / T1_0 1 Тс 11 0 0 11 120.94202 306.99997 тм (\ 240) Tj / T1_3 1 Тс -5.66901 1 тд (Разрешения) Tj ET BT / T1_0 1 Тс 10 0 0 10 141 278,99988 тм (\ 240) Tj 0 1 ТД (Сайт Rightlink.) Tj 0 1.00001 TD (Нажмите «Запросить разрешения», чтобы перейти на страницу защиты авторских прав \ Центр Рэнсиса \ (CCC \)) Tj 19.34296 1 тд (.) Tj 0 0 1 рг -19.34296 0 тд (http://mcr.aacrjournals.org/content/12/4/514)Tj 0 г 0 1 ТД (Чтобы запросить разрешение на повторное использование всей или части этой статьи, используйте это li \ nk) Tj ET BT / T1_0 1 Тс 9 0 0 9 259.14592 11 тм (16 мая 2021 г.\ 251 2014 Американская ассоциация исследований рака. ) Tj 0 0 1 рг -9.39096 0 тд (mcr.aacrjournals.org) Tj 0 г -8.11399 0 Тд (Загружено с) Tj ET BT / T1_0 1 Тс 9 0 0 9 158,17426 826 тм (Опубликовано в Интернете, впервые 24 января 2014 г .; DOI: 10.1158 / 1541-7786.MCR-13-05 \ 05) ТиДжей ET конечный поток эндобдж 179 0 объект > / Filter / FlateDecode / Height 231 / Length 74084 / Name / X / Subtype / Image / Type / XObject / Width 1539 >> stream HMlT̼ VR $ XJ% BUlS * lUwnJ? XhA InX (* BBB: H | `l33 ~ 3E BOws / +"

    FAK регулирует экспрессию E-кадгерина через p-Src Y416 / p-ERK 1/2 / p- Сигнальный путь Stat3 Y705 и PPARγ / miR-125b / Stat3 в клетках меланомы B16F10

    ВВЕДЕНИЕ

    Метастатическая меланома является одним из наиболее сложных для лечения злокачественных новообразований и является причиной 60–80% смертей от рака кожи [1, 2 ].Однако механизм, лежащий в основе миграции и метастазирования клеток меланомы, все еще плохо изучен. Киназа фокальной адгезии (FAK) - нерецепторная протеинтирозинкиназа, которая способствует адгезии, миграции и инвазии клеток [3]. Недавние исследования показали, что FAK сверхэкспрессируется в различных злокачественных опухолях, а уровень FAK положительно коррелирует со степенью злокачественности меланомы [4]. Сниженная экспрессия FAK блокировала клеточную инвазию, миграцию и метастазирование в нейробластоме [5].Ранее мы сообщали, что высокометастатические клетки B16F10 имели более высокий уровень экспрессии FAK, чем низкометастатические клетки F1 B16 [6].

    E-кадгерин представляет собой однопроходный трансмембранный гликопротеин, который опосредует межклеточные адгезии. Подавление E-кадгерина способствует миграции раковых клеток [7, 8]. Более того, потеря E-cadherin также способствует инвазивному и метастатическому поведению во многих эпителиальных опухолях [9, 10]. Снижение FAK привело к увеличению E-кадгерина в опухоли груди [11]. Недавнее исследование показало, что малая интерферирующая РНК Stat3 значительно увеличивает экспрессию E-cadherin, указывая на то, что Stat3 негативно регулирует экспрессию E-cadherin [12].

    В этом исследовании мы исследовали сигнальный путь, участвующий в ингибировании E-кадгерина посредством FAK. Также обсуждалась роль FAK как потенциальной мишени для терапии меланомы.

    РЕЗУЛЬТАТЫ

    Нокдаун FAK подавлял миграцию клеток B16F10 и метастазирование опухоли

    Мы сообщили, что уровень экспрессии FAK в высокометастатических клетках B16F10 выше, чем в низкометастатических клетках B16F1. Для дальнейшего изучения роли FAK в миграции / метастазировании клеток B16F10 мы сконструировали клеточные линии SiFAK и SiNC.По сравнению с таковыми в клетках SiNC, уровень мРНК FAK (рис. 1A) и уровни белков p-FAK и FAK (рис. 1B) заметно снизились в клетках SiFAK. Влияние FAK на миграцию клеток контролировали с помощью анализа трансвелл (рис. 1C) и анализа заживления ран (рис. 1D). Подавление FAK значительно подавляло миграцию клеток B16F10. Роль FAK в метастазировании опухоли in vivo была дополнительно исследована путем внутривенной инъекции клеток SiFAK или SiNC мышам C57BL / 6J.На что указывает уменьшение количества опухолевых узелков на поверхности легких мышей, которым вводили клетки SiFAK, подавление FAK заметно подавляло метастазирование опухоли (рис. 2A и 2B).

    Фигура 1: Понижающая регуляция FAK подавляла миграцию клеток B16F10. ( A ) Уровень мРНК FAK в клетках SiNC и SiFAK. ( B ) Экспрессия FAK и p-FAK Y397 в клетках SiNC и SiFAK. Также представлены результаты нормализованной денситометрии. ( C ) Миграцию клеток SiNC и SiFAK анализировали методом трансвелл.( D ) Миграцию клеток SiNC и SiFAK анализировали с помощью анализа заживления ран.

    Фигура 2: FAK способствовал метастазированию опухоли. ( A ) Опухолевые узелки, образовавшиеся в легких мыши, через 17 дней после того, как мышам были введены внутривенно клетки SiNC и SiFAK. ( B ) Количественный анализ опухолевых узлов. Результат выражали как среднее значение ± стандартное отклонение.

    Экспрессия генов, участвующих в миграции / метастазировании меланомы, была изменена в клетках SiFAK.

    Сообщалось, что ингибирование FAK снижает инвазию и метастатический потенциал рака [13].Потеря FAK была связана со снижением активности ERK 1/2 в эпителиальных клетках молочных желез. Предыдущее исследование показало, что снижение экспрессии FAK также увеличивает уровни E-кадгерина в опухолевых клетках [14]. E-кадгерин изменял взаимодействия клеток меланомы и подавлял инвазию и метастазирование опухолевых клеток. Потеря экспрессии E-cadherin была обычным явлением при меланоме [15-17]. Чтобы выявить механизм, лежащий в основе роли FAK в миграции / метастазировании опухоли, мы исследовали влияние нокдауна FAK на уровни Src, p-Src Y416 , ERK 1/2 , p-ERK 1/2 , Stat3, p-Stat3 Y705 и E-кадгерин по данным вестерн-блоттинга.Результаты показали, что стабильное вмешательство в экспрессию FAK в клетках SiFAK снижает уровни p-Src Y416 и p-ERK 1/2 , в то время как не влияет на уровни общего Src и ERK 1/2 (Рисунок 3A и 3Б). По сравнению с клетками SiNC, уровни Stat3 и p-Stat3 Y705 снизились в клетках SiFAK (рис. 3C). Однако вмешательство FAK значительно увеличивало экспрессию E-кадгерина (рис. 3D).

    Рисунок 3. Влияние FAK на экспрессию Src, p-Src Y416 , ERK 1/2 , p-ERK 1/2 , Stat3, p-Stat3 Y705 и E-кадгерина.( A ) Экспрессия Src и p-Src Y416 , ( B ) ERK 1/2 и p-ERK 1/2 , ( C ) Stat3 и p-Stat3 Y705 Экспрессию E-кадгерина и ( D ) в клетках SiNC и SiFAK исследовали с помощью вестерн-блоттинга. Также представлены результаты нормализованной денситометрии.

    Подавление FAK увеличивает экспрессию E-кадгерина через p-Src

    Y416 / p-ERK 1/2 / p-Stat3 Y705 сигнальный путь в клетке меланомы B16F10

    Аутофосфорилированный FAK по Tyr 397 (FAK Y397 ) может рекрутировать и фосфорилировать Src с последующим фосфорилированием ERK 1/2 с помощью p-Src [18].Инактивация ERK 1/2 снижает фосфорилирование Stat3 Y705 (p-Stat3 Y705 ) в клетках рака желудка человека [19]. Кроме того, существует отрицательная корреляция между p-Stat3 Y705 и экспрессией E-кадгерина при гепатоцеллюлярной карциноме [20]. Основываясь на наших предыдущих данных, мы предположили, что FAK может блокировать экспрессию E-cadherin через сигнальный путь p-Src Y416 / p-ERK 1/2 / p-Stat3 Y705 в клетках B16F10.Чтобы проверить эту гипотезу, клетки SiNC и SiFAK обрабатывали ингибитором Src (AZD0530) или ингибитором ERK 1/2 (U0126), и уровни белка p-Src Y416 , p-ERK 1/2 , p-Stat3 Y705 и E-кадгерин исследовали с помощью вестерн-блоттинга. Когда фосфорилирование Src Y416 (p-Src Y416 ) ингибировалось AZD0530, уровни p-ERK 1/2 и p-Stat3 Y705 резко снижались, в то время как E-кадгерин заметно увеличивался в SiNC. клетки (рис. 4А).Когда p-ERK 1/2 ингибировался U0126, p-Stat3 Y705 заметно снижался, в то время как E-кадгерин увеличивался в клетках SiNC (рис. 4B). Кроме того, короткая интерференционная РНК Src (SiSrc) или U0126 использовалась для лечения клеток SiFAK, и их влияние на Src, p-ERK 1/2 , p-Stat3 Y705 и E-кадгерин исследовали с помощью вестерн-блоттинга. . SiSrc снижал уровни p-ERK 1/2 и p-Stat3 Y705 и повышал уровень E-кадгерина в клетках SiFAK.Без какого-либо влияния на экспрессию Src, U0126 ингибировал p-ERK 1/2 и p-Stat3 Y705 и стимулировал экспрессию E-кадгерина (Рисунок 4C). Эти данные предполагают, что FAK ингибирует экспрессию E-кадгерина через сигнальный путь p-Src Y416 / p-ERK 1/2 / p-Stat3 Y705 в клетках B16F10.

    Фигура 4: p-Src Y416 / p-ERK 1/2 / p-Stat3 Y705 Сигнальный путь участвует в FAK-опосредованной экспрессии E-кадгерина. ( A ) Экспрессия p-Src Y416 , p-ERK 1/2 , p-Stat3 Y705 и E-кадгерина в клетках SiNC, инкубированных с или без ингибитора Src AZD0530 (5 мкМ) в течение 24 дней. часы.( B ) Экспрессия p-ERK 1/2 , p-Stat3 Y705 и E-Cadherin в клетках SiNC, инкубированных с или без ингибитора ERK 1/2 U0126 (10 мкМ) в течение 24 часов. ( C ) Экспрессия Src, p-ERK 1/2 , p-Stat3 Y705 и E-кадгерина в клетках SiFAK, инкубированных с U0126 (10 мкМ) или трансфицированных SiSrc. Также представлены результаты нормализованной денситометрии.

    FAK подавляла экспрессию E-кадгерина через сигнальный путь PPARγ / miR-125b / Stat3

    Как указано выше, мы обнаружили, что нокдаун FAK снижает Stat3 и p-Stat3 Y705 (рис. 3C), а FAK активирует p-Stat3 Y705 через сигнальный путь p-Src Y416 / p-ERK 1/2 .Но неясно, как FAK регулирует экспрессию Stat3. Накапливающиеся данные показали, что miRNAs нарушают регуляцию во время прогрессирования меланомы [21, 22]. Известно, что miRNA связываются с 3’-нетранслируемой областью (UTR) мРНК-мишени, чтобы ингибировать трансляцию белка. Предыдущее исследование показало, что экспрессия miR-125b подавляется при меланоме [23], а Stat3 является нижестоящей мишенью miR-125b [24]. На основе анализа общедоступных баз данных мы также обнаружили, что Stat3 был потенциальной мишенью для miR-125b (рис. 5A).Наши результаты QRT-PCR показали, что уровень miR-125b в клетках SiFAK был значительно выше, чем в клетках SiNC, что указывает на то, что miR-125b может участвовать в регуляции Stat3 с помощью FAK (рис. 5B). Сообщается, что нокдаун Stat3 значительно увеличивает экспрессию E-кадгерина в клетках колоректального рака [25]. Следовательно, FAK может ингибировать экспрессию E-кадгерина через сигнальный путь miR-125b / Stat3 в клетках B16F10. В нашем исследовании миметик miR-125b, ингибитор miR-125b и их отрицательные контроли были трансфицированы в клетки SiFAK соответственно.По сравнению с отрицательным контролем, миметик miR-125b уменьшал Stat3, в то время как увеличивал E-кадгерин (рис. 5C). Как и ожидалось, действие ингибитора miR-125b на экспрессию Stat3 и E-cadherin противоречило таковому у миметика miR-125b (фиг. 5D). Наши результаты свидетельствуют о том, что FAK ингибирует экспрессию E-кадгерина через сигнальный путь miR-125b / Stat3 в клетках меланомы B16F10.

    Фигура 5: miR-125b способствует экспрессии E-кадгерина. ( A ) Дуплекс между miR-125b и 3 'UTR мыши stat3, предсказанный mirbase (http: // www.mirbase.org). ( B ) Экспрессию miR-125b в клетках SiNC и SiFAK исследовали с помощью QRT-PCR. Результаты выражали как среднее значение ± стандартное отклонение. ( C ) Экспрессия Stat3 и E-кадгерина в клетках SiFAK, трансфицированных миметиком miR-125b и NC. ( D ) Экспрессия Stat3 и E-кадгерина в клетках SiFAK, трансфицированных ингибитором miR-125b и NC. Также представлены результаты нормализованной денситометрии.

    Однако еще предстоит выяснить, как FAK ингибирует экспрессию miR-125b.Известно, что PPARγ может способствовать экспрессии miR-125b путем прямого связывания с чувствительным элементом в промоторной области гена miR-125b [26]. В нашем исследовании мы изучали, участвует ли PPARγ в регуляции miR-125b. По сравнению с таковыми в клетках SiNC, уровни белка PPARγ и E-кадгерина были выше в клетках SiFAK после обработки активатором PPARγ (троглитамин, Trog) (рис. 6A). Затем интерференционные РНК PPARγ (SiPPARγ-1 и SiPPARγ-2) и их отрицательный контроль трансфицировали в клетки SiFAK (фиг.6B).В результате мы обнаружили, что miR125b подавляется после нокдауна PPARγ (фиг. 6C), предполагая, что FAK ингибирует экспрессию miR-125b путем репрессии экспрессии PPARγ. Между тем, вмешательство PPARγ увеличивало уровень белка Stat3 и снижало уровень E-кадгерина (рис. 6D). Взятые вместе, FAK подавляла экспрессию E-кадгерина через сигнальный путь PPARγ / miR-125b / Stat3.

    Фигура 6: PPARγ стимулировал экспрессию miR-125b. ( A ) Экспрессия PPARγ и E-кадгерина в клетках SiNC и SiFAK, которые инкубировали с Trog (20 мкМ).( B ) Экспрессия мРНК PPARγ в клетках SiFAK, трансфицированных PPARγ интерференционной РНК SiPPARγ-1, SiPPARγ-2 и обработанных Trog (20 мкМ). ( C ) QRT-PCR проверяла экспрессию miR-125b в клетках SiFAK после трансфекции интерференционной РНК PPARγ SiPPARγ-1, SiPPARγ-2 и инкубирования с Trog (20 мкМ). ( D ) Экспрессия PPARγ, Stat3 и E-кадгерина в клетках SiFAK после трансфекции PPARγ интерференционной РНК SiPPARγ-1, SiPPARγ-2 и инкубирования с Trog (20 мкМ).Также представлены результаты нормализованной денситометрии.

    miR-125b подавляет миграцию клеток B16F10

    Недавнее исследование показало, что miR-125b может функционировать как опухолевый супрессор при меланоме [27]. Чтобы проверить, может ли miR-125b ингибировать миграцию клеток B16F10, миметик miR-125b, ингибитор miR-125b и их отрицательный контроль трансфицировали в клетки B16F10. Результаты RTCA показали, что миметик miR-125b значительно уменьшал миграцию клеток B16F10 (фиг. 7A и 7B), в то время как ингибитор miR-125b заметно увеличивал миграцию клеток B16F10 (фиг. 7C и 7D).Наши данные показали, что miR-125b подавляет миграцию клеток B16F10.

    Фигура 7: miR-125b ингибирует миграцию клеток B16F10. ( A , B ) Миграцию клеток B16F10, трансфицированных миметиком miR-125b и отрицательным контролем, анализировали с помощью RTCA. ** означает p <0,01. ( C , D ) Миграцию клеток B16F10, трансфицированных ингибитором miR-125b и отрицательным контролем, анализировали с помощью RTCA. * означает p <0,05.

    Нарушение экспрессии генов FAK, Src, ERK

    1/2 , PPARγ, C21orf34, Stat3 и E-кадгерин связаны с метастазами у пациентов с меланомой

    Чтобы установить, действительно ли FAK, Src, ERK 1/2 PPARγ, C21orf34 (ген хозяина miR-125b), Stat3 и E-кадгерин по-разному экспрессировались в тканях меланомы человека, мы сначала проанализировали их уровни мРНК при раке меланомы с использованием базы данных Oncomine Cancer Microarray (www.oncomine.org). Как показал набор данных меланомы Райкера, экспрессия FAK, ERK 1/2 активируется, в то время как экспрессия PPARγ, C21orf34 и E-кадгерина подавляется при метастатической меланоме по сравнению с нормальным контролем ( Рисунок 8A).Как показывает набор данных меланомы Талантова, по сравнению с нормальным контролем, экспрессия FAK, Src, ERK 1/2 и Stat3 повышена, тогда как экспрессия PPARγ понижена при метастатической меланоме (рис. 8B). ). Результаты из базы данных Oncomine согласуются с нашими данными о клетках B16F10, что указывает на то, что наши результаты могут быть полезны для лечения меланомы.

    Фигура 8: Уровни мРНК FAK, Src, ERK 1/2 , PPARγ, C21orf34, Stat3 и E-кадгерина в меланоме человека были получены из базы данных Oncomine.( A ) Уровни мРНК FAK, ERK 1/2 , PPARγ, C21orf34 и E-кадгерина анализировали в наборе данных по меланоме Райкера. ( B ) Уровни мРНК FAK, Src, ERK 1/2 , PPARγ и Stat3 анализировали в наборе данных по меланоме Талантова. * p <0,05, ** p <0,01, *** p <0,001. ( C ) Предложенная модель регуляции миграции клеток с помощью FAK в клетке меланомы.

    Мы также проанализировали уровень мРНК FAK, Src, ERK 1/2 , PPARγ, C21orf34, Stat3 и E-кадгерина при раке груди человека с использованием базы данных Oncomine Cancer Microarray.По сравнению с нормальным контролем, экспрессия FAK, Src, ERK 1/2 и Stat3 активируется, в то время как экспрессия PPARγ, C21orf34 и E-кадгерина подавляется при раке молочной железы TCGA (дополнительная таблица 1) и Рак груди у Турашвили (дополнительная таблица 2). Результаты рака груди подтвердили результаты метастатической меланомы, указывая на то, что FAK регулирует экспрессию E-кадгерина через p-Src Y416 / p-ERK 1/2 / p-Stat3 Y705 и передачу сигналов PPARγ / miR-125b / Stat3. путь (рис. 8C).

    ОБСУЖДЕНИЕ

    В этом исследовании мы продемонстрировали, что нокдаун FAK ингибирует миграцию и метастазирование клеток B16F10, и дополнительно исследовали лежащий в основе механизм. Наши данные показали, что подавление FAK ингибирует фосфорилирование Src и ERK 1/2 . Кроме того, нокдаун FAK подавил уровни Stat3 и p-Stat3 Y705 . Приведенные выше результаты согласуются с недавним сообщением о том, что нокдаун FAK ингибирует активацию ERK 1/2 в SMC сосудов крыс [28], а снижение p-ERK 1/2 ингибирует активацию Stat3 в MCF-7 и MDA- Клетки MB-231 [29].Кроме того, мы обнаружили, что FAK ингибирует экспрессию E-кадгерина через сигнальный путь P-Src Y416 / p-ERK 1/2 / p-Stat3 Y705 .

    Однако еще предстоит выяснить, как сигнальный путь FAK ингибирует экспрессию Stat3 и участвует ли Stat3 в регуляции E-cadherin. Предыдущее исследование показало, что miR-125b взаимодействует с 3'-UTR мРНК Stat3, подавляя экспрессию гена. На основе общедоступной базы данных (mirbase, http: // www.mirbase.org), Stat3 оказался потенциальной мишенью для miR-125b. Кроме того, недавнее исследование также сообщает, что экспрессия miR-125b подавляется при кожной злокачественной меланоме [30], а miR-125b действует как опухолевый супрессор при опухолях печени и кожной злокачественной меланоме [31, 32]. Поэтому мы дополнительно исследовали роль miR-125b в клетке B16F10. Мы обнаружили, что нокдаун FAK способствует экспрессии miR-125b. Миметик miR-125b ингибировал экспрессию Stat3, в то же время способствуя экспрессии E-кадгерина.На основании дальнейших исследований мы обнаружили, что FAK подавляет экспрессию miR-125b посредством подавления PPARγ. Кроме того, мы обнаружили, что miR-125b может ингибировать миграцию клеток B16F10.

    Все приведенные выше данные, полученные на линии клеток мыши B16F10, предполагают, что FAK регулирует экспрессию E-кадгерина через p-Src Y416 / p-ERK 1/2 / p-Stat3 Y705 и PPARγ / miR-125b / Сигнальный путь Stat3. Мы также повторили ключевые эксперименты на линии клеток меланомы человека A375. Интерференционная РНК FAK и ее отрицательный контроль трансфицировали в клетки A375, и уровни некоторых белков исследовали с помощью вестерн-блоттинга.Когда экспрессия FAK была заблокирована, уровни белка p-Src Y416 , p-ERK 1/2 , Stat3 и p-Stat3 Y705 были подавлены, в то время как уровни белка PPARγ и E- cadherin были активированы (дополнительная фигура 1A). Затем интерференционная РНК Src (дополнительная фигура 1B), U0126 (дополнительная фигура 1C) и интерференционная РНК PPARγ (дополнительная фигура 1C) были использованы для обработки клеток A375, а уровни белка Src, p-ERK 1/2 Были исследованы , PPARγ, Stat3, p-Stat3 Y705 и E-кадгерин.Результаты для клеток A375 совпадают с результатами, полученными для клеток B16F10, что указывает на то, что две клеточные линии имеют общий путь, лежащий в основе репрессии экспрессии E-кадгерина с помощью FAK.

    Клеточные линии меланомы мыши B16F10 и B16F1 были получены из их родительской клеточной линии B16F0 путем клональной селекции метастатической опухоли [6]. В соответствии со ссылкой, мы обнаружили, что уровень экспрессии FAK в высокометастатических клетках B16F10 намного выше, чем в низкометастатических клетках B16F1 (дополнительный рисунок 2).Используя клеточные линии B16F10 и B16F1, мы исследовали влияние активированной FAK на гены, участвующие в миграции / метастазировании меланомы. По сравнению с таковыми в клетках B16F10, уровни белка p-Src Y416 , p-ERK 1/2 , Stat3 и p-Stat3 Y705 снизились, в то время как уровни белка PPARγ и E-кадгерина увеличились в клетках B16F1. (Дополнительный рисунок 2). Приведенные выше результаты совпадают с результатами, полученными для клеток SiFAK и SiNC, что позволяет предположить, что FAK / p-Src Y416 / p-ERK 1/2 / p-Stat3 Y705 / E-cadherin и FAK / PPARγ / miR. -125b / Stat3 / E-cadherin сигнальный путь также работает, когда экспрессия FAK активирована.

    Как показывают данные из базы данных Oncomine, по сравнению с нормальным контролем, экспрессия мРНК FAK, Src, ERK 1/2 , Stat3 увеличилась, в то время как экспрессия PPARγ, C21orf34 и E-кадгерина снизилась при раке меланомы человека и рак молочной железы. В заключение, наши данные показали, что FAK ингибирует экспрессию E-кадгерина через p-Src Y416 / p-ERK 1/2 / p-Stat3 Y705 и PPARγ / miR-125b / Stat3 сигнальный путь в обоих клетки меланомы и опухоли человека.Наше исследование предполагает, что FAK может быть потенциальной мишенью для лечения меланомы.

    МАТЕРИАЛЫ И МЕТОДЫ

    Биохимические вещества и антитела

    AZD0530, U0126 и бластицидин были получены от Sigma-Aldrich, Cell Signaling и Invitrogen, соответственно. Первичные антитела против FAK, фосфорилированного FAK (p-FAK Y397 ) и E-кадгерина были приобретены у BD Biosciences. Первичные антитела против Src, фосфорилированный Src (p-Src Y416 ), Stat3, фосфорилированный Stat3 (p-Stat3 Y705 ), ERK 1/2 , фосфорилированный ERK 1/2 (p-ERK 1 / 2 ) и PPARγ были получены от Cell Signaling.Первичные антитела против тубулина, актина и GAPDH были получены из Санта-Крус.

    Клеточные культуры

    Клеточная линия SiFAK (стабильная интерференция FAK в клетках B16F10) и клеточная линия SiNC (отрицательный контроль для SiFAK) были сконструированы путем стабильной трансфекции плазмиды pcDNA6.2-GW / EmGFP-miR, несущей малую интерферирующую РНК FAK или siFAK скремблирует siRNA в клетки B16F10 соответственно [33]. Клетки культивировали при 37 ° C и 5% CO 2 в среде Игла, модифицированной Дульбекко (DMEM) с добавлением 10% фетальной бычьей сыворотки (Life Technologies, США) и 3 мг · л -1 бластицидина.

    Анализ миграции

    Миграцию клеток контролировали с помощью анализа трансвелл, анализатора клеток в реальном времени (RTCA) и анализов заживления ран. Для анализа через лунки 1 × 10 5 клеток на вставку (размер пор 8 мкм) инкубировали в бессывороточной среде DMEM в течение 24 часов. Затем клетки внутри вставок удаляли ватным тампоном, а клетки на нижней стороне вставок фиксировали и окрашивали. Сделав фотографии пяти полей и подсчитав общее количество ячеек, было вычислено среднее количество ячеек на поле.

    Система DP анализатора клеток в реальном времени (RTCA) × CELLigence была использована для мониторинга адгезии клеток. После уравновешивания планшетов CIM-Plate-16 в течение 1 часа в увлажненной атмосфере при 37 ° C 2,0 × 10 4 клеток / лунку в бессывороточной среде переносили в CIM-Plate-16 с 3 повторами. Импеданс контролировался непрерывно в течение 30 часов в соответствии с инструкциями производителя, и данные отображались в виде индекса ячейки. Для анализа заживления ран клетки высевали с начальной плотностью 2 × 10 90 · 10 5 5 90 · 106 клеток / лунку и культивировали в DMEM с добавлением 10% фетальной бычьей сыворотки в течение ночи.Затем клетки культивировали в бессывороточной среде DMEM в течение 24 часов. Наконечник микропипетки использовали для создания раны в монослое клеток. Закрытие ран наблюдали с помощью фазово-контрастной микроскопии, и цифровые изображения получали с интервалом времени 0 и 24 часа.

    Метастаз в хвостовой вене

    Самок мышей C57BL / 6J (возраст 6-8 недель) были приобретены в Центре сравнительной медицины Университета Янчжоу (Янчжоу, Китай). Мышам C57BL / 6J внутривенно вводили клетки SiFAK или SiNC (5 × 10 5 ) через хвост.Через 17 дней мышей умерщвляли, их легкие собирали и фотографировали. Под макроскопом подсчитывали количество опухолевых узелков на поверхности легких.

    Выделение тотальной РНК и количественная ПЦР в реальном времени (QRT-PCR)

    Суммарную РНК экстрагировали из линий клеток SiNC и SiFAK с помощью реагента TRIzol (Invitrogen, США). Количество и чистоту РНК определяли на биофотометре (Eppendorf, Германия). КДНК первой цепи синтезировали с 1,5 мкг тотальной РНК с использованием набора реагентов PrimeScript RT (Takara, Япония).QRT-PCR выполняли с использованием FastStart Universal SYBR Green Master [Rox] (Roche, Swiss). Ген-специфические праймеры были синтезированы Nanjing Genscript (Нанкин, Китай). U6 использовали для нормализации данных экспрессии miR-125b.

    U6-RT: 5'-CTCAACTGGTGTCGTGGAGTCGGC AATTCAGTTGAGAAAAATATGGAACGCT-3 'U6-F: 5'-CTGGTAGGGTGCTCGCTTCGGCAG-3' U6- R: 5'- CAACTGGTGTCGTGGAGTCGGC-3 'микроРНК-125b- RT: 5'-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTT GAGTACAA-3' miR-125b -F: 5'-CGCGCTCCCTGAGA CCCTAAC-3 'miR-125b- R: 5'-TGGTGTCGTGGAG TCG-3' FAK-F: 5'-AAAGCAGTAGTGAGCCAACAA-3 'FAK-R: 5'-CTGAGGAGCGAAAT -F: 5'- ATCTTAACTGCCGGATCCAC -3 'PPARγ-R: 5'- GA TGGCATTGTGAGACATCC -3' GAPDH-F: 5'-TGAAGC AGGCATCTGAGGG-3 'GAPDH-R: 5'-CGAAGGTGGA 3'GAGTGGAG.

    РНК трансфекция

    миметик miR-125b, отрицательный контроль (NC) миметик miR-125b, ингибитор miR-125b, ингибитор NC miR-125b, интерференционная РНК Src (SiSrc) и интерференционная РНК олигонуклеотидов PPARγ (SiPPARγ) компании GenePharma (Шанхай, Китай). SiPPARγ-1-F: 5′-GCGAUCUUGACAGGAAAGATT-3 ′ SiPPARγ-1-R: 5′-UCUUUCCUGUCAAGAUCGCTT-3 ′ SiPPARγ-2-F: 5′-GACAGUGACUUGTACUGCUAUAUTT-3 ′ -SiPPARγ-2-F: 5 ′ 3 'SiSrc-F: 5'-CU GUAUCCGACUUCGACAATT -3' SiSrc-R: 5'-UUGU CGAAGUCGGAUACAGTT-3 'miR-125b миметик-F: 5'-UCCCUGAGACCCUAACUUGUGA-3'- miR-125b: m ACAAGUUAGGGUCUCAGGGAUU-3 'NC для SiPPARγ, SiSrc и miR-125b, миметик NC-F: 5'-U UCUCCGAACGUGUCACGUTT-3' NC-R: 5'-ACGUG ACACGUUCGGAAATTU-3 'miR-125B-ингибитор CAAGG: 'Ингибитор miR-125b - NC: 5'-CAGUACUUUUGUGUAGUACAA-3'. Клетки трансфицировали РНК в соответствии с протоколом Lipofectamine 2000 (Invitrogen, США) и культивировали в течение 48 часов перед сбором.

    Вестерн-блоттинг

    Клетки лизировали, общие белки фракционировали с помощью SDS-PAGE и переносили на нитроцеллюлозную мембрану. Мембрану блокировали 5% обезжиренным сухим молоком в 1 × PBST-буфере, а затем инкубировали с соответствующими первичными антителами в течение одного часа. Конъюгированные с пероксидазой хрена антимышиные или кроличьи IgG использовали в качестве вторичных антител, белковые полосы детектировали с использованием системы обнаружения повышенной хемилюминесценции (Tanon, Шанхай, Китай).Плотность различных полос белка анализировали с помощью программного обеспечения Chemianalysis, и значение анализа плотности помечали под каждой полосой белка.

    Статистический анализ

    Эксперименты проводили в трех повторностях. Данные представлены в виде среднего значения ± стандартное отклонение и проанализированы с использованием теста Стьюдента t . Статистическая значимость была определена следующим образом: * p <0,05; ** p <0,01; *** р <0,001.

    Сокращения

    FAK: Киназа фокальной адгезии; GAPDH: глицеральдегид-3-фосфатдегидрогеназа; NC: нормальный контроль; PBST: фосфатно-солевой буфер с твином; QRT-PCR: количественная ПЦР в реальном времени; 3'-UTR: 3'-нетранслируемые области; Трог: троглитамин; Клеточная линия SiFAK: стабильная интерференция FAK в клетках B16F10; Клеточная линия SiNC: отрицательный контроль для клеточной линии SiFAK; RTCA: анализатор клеток в реальном времени.

    БЛАГОДАРНОСТИ

    Авторы хотели бы поблагодарить Мин Лу и Тунъян Чжу за их помощь в создании экспериментального оборудования и материалов.

    КОНФЛИКТ ИНТЕРЕСОВ

    Авторы заявляют, что у них нет конкурирующих интересов.

    Согласие на публикацию

    Не применимо.

    Одобрение этических норм и согласие на участие

    Все протоколы использования животных были одобрены Комитетом по уходу и использованию животных Школы естественных наук Нанкинского университета.

    ФИНАНСИРОВАНИЕ

    Эта работа была поддержана грантами Национального фонда естественных наук Китая (81630092, 81573338, 81421091, 30425009, 30330530, 31200572, 81121062, 31071196), Национальной программы ключевых исследований Министерства науки и технологий (2014CB744501, 2016YFC0

    0), Научный фонд докторантуры Министерства образования Китая (201300003), Комитет по науке и технологиям Шэньчжэня (JCYJ20160331152141936) и Павлиний план Шэньчжэня (KQTD20140630165057031).

    СПИСОК ЛИТЕРАТУРЫ

    1. Хаттак М., Фишер Р., Тураджлик С., Ларкин Дж. Таргетная терапия и иммунотерапия при запущенной меланоме: развивающаяся парадигма. Терапевтические достижения в медицинской онкологии. 2013; 5: 105–118.

    2. Бандарчи Б., Джаббари К.А., Ведади А., Наваб Р. Молекулярная биология нормальных меланоцитов и клеток меланомы. Журнал клинической патологии. 2013; 66: 644–648.

    3. Kanteti R, Batra SK, Lennon FE, Salgia R. FAK и паксиллин, две потенциальные мишени при раке поджелудочной железы.Oncotarget. 2016; 7: 31586–31601. DOI: 10.18632 / oncotarget.8040.

    4. Schaller MD. Клеточные функции киназ FAK: понимание молекулярных механизмов и новых функций. Журнал клеточной науки. 2010; 123: 1007–1013.

    5. Мегисон М.Л., Стюарт Дж. Э., Наберс ХК, Гиллори Л.А., Байерле Э.А. Ингибирование FAK снижает клеточную инвазию, миграцию и метастазирование в нейробластоме, амплифицированной MYCN. Клинические и экспериментальные метастазы. 2013; 30: 555–568.

    6. Ли С., Хуанг Х, Чжан Д., Хуанг Ц., Пей Дж., Ван Л., Цзян В., Ху Ц., Тан Р., Хуа Ц.Необходимость PEA3 для транскрипционной активации гена FAK при метастазировании опухоли. ПлоС один. 2013; 8: e79336.

    7. Xiong S, Klausen C, Cheng JC, Leung PC. Активин B способствует миграции клеток рака эндометрия путем подавления E-кадгерина посредством SMAD-независимой передачи сигналов MEK-ERK1 / 2-SNAIL. Oncotarget. 2016; 7: 40060–40072. DOI: 10.18632 / oncotarget.9483.

    8. Song Y, Li J, Zhu Y, Dai Y, Zeng T, Liu L, Wang H, Qin Y, Zeng M, Guan XY, Li Y. MicroRNA-9 способствует метастазированию опухоли путем подавления E-кадгерина в пищеводе плоскоклеточная карцинома.Oncotarget. 2014; 5: 11669–11680. DOI: 10.18632 / oncotarget.2581.

    9. Ван Рой Ф., Берк Дж. Молекула межклеточной адгезии Е-кадгерин. Клеточные и молекулярные науки о жизни. 2008; 65: 3756–3788.

    10. Birchmeier W, Behrens J. Экспрессия кадгерина в карциномах: роль в формировании соединений клеток и предотвращении инвазивности. Biochimica et Biophysica Acta (BBA) - Обзоры рака. 1994; 1198: 11–26.

    11. Kong X, Li G, Yuan Y, He Y, Wu X, Zhang W, Wu Z, Chen T, Wu W., Lobie PE, Zhu T.МикроРНК-7 ингибирует эпителиально-мезенхимальный переход и метастазирование клеток рака молочной железы посредством нацеливания на экспрессию FAK. ПлоС один. 2012; 7: e41523.

    12. Ко ХС, Чой С.К., Кан ХК, Ким ХС, Чон Дж. Х., Пак И. Ю., Шин Дж. Онкостатин M стимулирует миграцию и пролиферацию клеток путем подавления E-кадгерина в клеточной линии HTR8 / SVneo посредством активации STAT3. Репрод Биол Эндокрин. 2013; 11.

    13. Wendt MK, Schiemann WP. Терапевтическое воздействие на комплекс фокальной адгезии предотвращает онкогенную передачу сигналов TGF-бета и метастазирование.Исследование рака груди. 2009; 11: R68.

    14. Надь Т., Вэй Х, Шен Т.Л., Пэн Х, Лян С.К., Ган Б., Гуань Дж.Л. Специфичная для молочного эпителия делеция гена киназы фокальной адгезии приводит к тяжелой лобуло-альвеолярной гипоплазии и секреторной незрелости молочной железы мыши. Журнал биологической химии. 2007; 282: 31766–31776.

    15. Ikoma N, Yamazaki H, Abe Y, Oida Y, Ohnishi Y, Suemizu H, Matsumoto H, Matsuyama T., Ohta Y, Ozawa A, Ueyama Y, Nakamura M. Экспрессия S100A4 с пониженной экспрессией E-кадгерина предсказывает отдаленные метастазирование клеточных линий злокачественной меланомы человека на мышиной модели NOD / SCID / gammaCnull (NOG).Отчеты онкологии. 2005; 14: 633–637.

    16. Tucci MG, Lucarini G, Brancorsini D, Zizzi A, Pugnaloni A, Giacchetti A, Ricotti G, Biagini G. Вовлечение E-кадгерина, бета-катенина, Cdc42 и CXCR4 в прогрессирование и прогноз кожной меланомы. Британский дерматологический журнал. 2007; 157: 1212–1216.

    17. Крайзенбек Г.М., Бергер А.Дж., Субтил А., Римм Д.Л., Гоулд Ротберг Б.Е. Прогностическое значение адгезионных молекул на основе кадгерина при злокачественной меланоме кожи. Эпидемиология рака, биомаркеры и профилактика.2008; 17: 949–958.

    18. Wu X, Yang L, Zheng Z, Li Z, Shi J, Li Y, Han S, Gao J, Tang C, Su L, Hu D. Src способствует заживлению кожных ран, регулируя MMP-2 через ERK путь. Международный журнал молекулярной медицины. 2016; 37: 639–648.

    19. Kanai M, Konda Y, Nakajima T., Izumi Y, Kanda N, Nanakin A, Kubohara Y, Chiba T. Фактор-1, индуцирующий дифференцировку (DIF-1), подавляет активность STAT3, участвующую в пролиферации клеток рака желудка через MEK -ERK-зависимый путь. Онкоген.2003; 22: 548–554.

    20. Zhang CH, Xu GL, Jia WD, Li JS, Ma JL, Ren WH, Ge YS, Yu JH, Liu WB, Wang W. Активация сигнального пути STAT3 коррелирует с экспрессией скручивания и E-кадгерина в гепатоцеллюлярной карциноме и их клиническое значение. Журнал хирургических исследований. 2012; 174: 120–129.

    21. Гаур А., Джуэлл Д.А., Лян Ю., Ридзон Д., Мур Дж. Х., Чен С., Амброс В. Р., Израиль Массачусетс. Характеристика уровней экспрессии микроРНК и их биологических коррелятов в линиях раковых клеток человека.Исследования рака. 2007; 67: 2456–2468.

    22. Мюллер Д.В., Рели М, Боссерхофф А.К. Профили экспрессии miRNA в меланоцитах и ​​клеточных линиях меланомы выявляют miRNA, связанные с образованием и прогрессированием злокачественной меланомы. Журнал исследовательской дерматологии. 2009; 129: 1740–1751.

    23. Latchana N, Ganju A, Howard JH, Carson WE, 3rd. Нарушение регуляции микроРНК при меланоме. Хирургическая онкология. 2016; 25: 184–189.

    24. Лю Л. Х., Ли Х, Ли Дж. П., Чжун Х, Чжан Х. К., Чен Дж., Сяо Т.miR-125b подавляет пролиферацию и миграцию клеток остеосаркомы посредством подавления STAT3. Biochem Biophys Res Commun. 2011; 416: 31–38.

    25. Xiong H, Zhang ZG, Tian XQ, Sun DF, Liang QC, Zhang YJ, Lu R, Chen YX, Fang JY. Ингибирование передачи сигналов JAK1, 2 / STAT3 вызывает апоптоз, остановку клеточного цикла и снижает инвазию опухолевых клеток в клетки колоректального рака. Неоплазия. 2008; 10: 287–297.

    26. Луо С., Ван Дж, Ма И, Яо З, Пан Х. PPARgamma ингибирует пролиферацию клеток рака яичников за счет активации miR-125b.Сообщения о биохимических и биофизических исследованиях. 2015; 462: 85–90.

    27. Nyholm AM, Lerche CM, Manfe V, Biskup E, Johansen P, Morling N, Thomsen BM, Glud M, Gniadecki R. miR-125b вызывает клеточное старение при злокачественной меланоме. BMC дерматология. 2014; 14: 8.

    28. Ши З.Д., Ван Х., Тарбелл Дж. М.. Гепарансульфатные протеогликаны опосредуют механотрансдукцию интерстициального потока, регулируя экспрессию MMP-13 и подвижность клеток через FAK-ERK в 3D-коллагене. ПлоС один. 2011; 6.

    29.Раджпут С., Дей К.К., Ипсита П., Сен К., Дей Г., Бхарти Р., Парида С., Парех А., Мандал М. Комбинаторный эффект ZD6474 и тимохинона подавляет опосредованную Src передачу сигналов ERK-1/2 / STAT3 и оказывает антиметастазирование при раке молочной железы . Европейский журнал рака. 2012; 48: 61–61.

    30. Глуд М., Россинг М., Хотер С., Холст Л., Хаструп Н., Нильсен ФК, Гнядецки Р., Джевецки К.Т. Подавление miR-125b при метастатической кожной злокачественной меланоме. Melanoma Res. 2010; 20: 479–484.

    31. Ван XH, Тан С., Ле С.Ю., Лу Р., Райдер Дж. С., Мейерс С., Чжэн З.М.Аберрантная экспрессия онкогенных и опухолевых микроРНК при раке шейки матки необходима для роста раковых клеток.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *